PSMA7 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80749-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMA7 Reagents
CRO Services
Product recommended

All PSMA7 Reagents
PSMA7 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
747 bp
Description
Full length Clone DNA of Rat proteasome (prosome, macropain) subunit, alpha type 7 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMA7 Background Information
Full Name
proteasome (prosome, macropain) subunit, alpha type, 7

PSMA7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMA7 cDNA ORF Clone in Cloning Vector, Rat RG80749-U
PSMA7 cDNA ORF Clone, Rat, untagged RG80749-UT
PSMA7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80749-ACGLN
PSMA7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80749-ACG
PSMA7 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80749-ANG
PSMA7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80749-ACR
PSMA7 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80749-ANR
PSMA7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80749-CF
PSMA7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80749-NF
PSMA7 cDNA ORF Clone, Rat, C-His tag RG80749-CH
PSMA7 cDNA ORF Clone, Rat, N-His tag RG80749-NH
PSMA7 cDNA ORF Clone, Rat, C-HA tag RG80749-CY
PSMA7 cDNA ORF Clone, Rat, N-HA tag RG80749-NY
PSMA7 cDNA ORF Clone, Rat, C-Myc tag RG80749-CM
PSMA7 qPCR Primer Pairs, Rat RP300713

PSMA7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMA7 cDNA ORF Clone in Cloning Vector, Mouse MG53783-U
PSMA7 cDNA ORF Clone, Mouse, untagged MG53783-UT
PSMA7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53783-ACG
PSMA7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53783-ACGLN
PSMA7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53783-ANG
PSMA7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53783-ACR
PSMA7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53783-ANR
PSMA7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53783-CF
PSMA7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53783-NF
PSMA7 cDNA ORF Clone, Mouse, C-His tag MG53783-CH
PSMA7 cDNA ORF Clone, Mouse, N-His tag MG53783-NH
PSMA7 cDNA ORF Clone, Mouse, C-HA tag MG53783-CY
PSMA7 cDNA ORF Clone, Mouse, N-HA tag MG53783-NY
PSMA7 cDNA ORF Clone, Mouse, C-Myc tag MG53783-CM
PSMA7 cDNA ORF Clone, Mouse, N-Myc tag MG53783-NM

PSMA7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMA7 cDNA ORF Clone in Cloning Vector, Human HG16827-U
PSMA7 cDNA ORF Clone, Human, untagged HG16827-UT
PSMA7 cDNA ORF Clone, Human, C-GFPSpark® tag HG16827-ACG
PSMA7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16827-ACGLN
PSMA7 cDNA ORF Clone, Human, N-GFPSpark® tag HG16827-ANG
PSMA7 cDNA ORF Clone, Human, C-OFPSpark® tag HG16827-ACR
PSMA7 cDNA ORF Clone, Human, N-OFPSpark® tag HG16827-ANR
PSMA7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16827-CF
PSMA7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16827-NF
PSMA7 cDNA ORF Clone, Human, C-His tag HG16827-CH
PSMA7 cDNA ORF Clone, Human, N-His tag HG16827-NH
PSMA7 cDNA ORF Clone, Human, C-HA tag HG16827-CY
PSMA7 cDNA ORF Clone, Human, N-HA tag HG16827-NY
PSMA7 cDNA ORF Clone, Human, C-Myc tag HG16827-CM
PSMA7 cDNA ORF Clone, Human, N-Myc tag HG16827-NM
info info
添加购物车成功! 添加购物车失败!