PRRC1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80914-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRRC1 Reagents
CRO Services
Product recommended

All PRRC1 Reagents
PRRC1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1332 bp
Description
Full length Clone DNA of Rat proline-rich coiled-coil 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRRC1 Background Information
Full Name
proline rich coiled-coil 1

PRRC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PRRC1 cDNA ORF Clone in Cloning Vector, Rat RG80914-U
PRRC1 cDNA ORF Clone, Rat, untagged RG80914-UT
PRRC1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80914-ACG
PRRC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80914-ACGLN
PRRC1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80914-ACR
PRRC1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80914-CF
PRRC1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80914-NF
PRRC1 cDNA ORF Clone, Rat, C-His tag RG80914-CH
PRRC1 cDNA ORF Clone, Rat, N-His tag RG80914-NH
PRRC1 cDNA ORF Clone, Rat, C-HA tag RG80914-CY
PRRC1 cDNA ORF Clone, Rat, N-HA tag RG80914-NY
PRRC1 cDNA ORF Clone, Rat, C-Myc tag RG80914-CM
PRRC1 qPCR Primer Pairs, Rat RP300878

PRRC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRRC1 cDNA ORF Clone in Cloning Vector, Mouse MG54539-U
PRRC1 cDNA ORF Clone, Mouse, untagged MG54539-UT
PRRC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54539-ACG
PRRC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54539-ACGLN
PRRC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54539-ANG
PRRC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54539-ACR
PRRC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54539-ANR
PRRC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54539-CF
PRRC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54539-NF
PRRC1 cDNA ORF Clone, Mouse, C-His tag MG54539-CH
PRRC1 cDNA ORF Clone, Mouse, N-His tag MG54539-NH
PRRC1 cDNA ORF Clone, Mouse, C-HA tag MG54539-CY
PRRC1 cDNA ORF Clone, Mouse, N-HA tag MG54539-NY
PRRC1 cDNA ORF Clone, Mouse, C-Myc tag MG54539-CM
PRRC1 cDNA ORF Clone, Mouse, N-Myc tag MG54539-NM

PRRC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRRC1 cDNA ORF Clone in Cloning Vector, Human HG16527-G
PRRC1 cDNA ORF Clone, Human, untagged HG16527-UT
PRRC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16527-ACGLN
PRRC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16527-ACG
PRRC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16527-ANG
PRRC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16527-ACR
PRRC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16527-ANR
PRRC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16527-CF
PRRC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16527-NF
PRRC1 cDNA ORF Clone, Human, C-His tag HG16527-CH
PRRC1 cDNA ORF Clone, Human, N-His tag HG16527-NH
PRRC1 cDNA ORF Clone, Human, C-HA tag HG16527-CY
PRRC1 cDNA ORF Clone, Human, N-HA tag HG16527-NY
PRRC1 cDNA ORF Clone, Human, C-Myc tag HG16527-CM
PRRC1 cDNA ORF Clone, Human, N-Myc tag HG16527-NM
info info
添加购物车成功! 添加购物车失败!