PRPF4 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80924-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRPF4 Reagents
CRO Services
Product recommended

All PRPF4 Reagents
PRPF4 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1566 bp
Description
Full length Clone DNA of Rat PRP4 pre-mRNA processing factor 4 homolog (yeast) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRPF4 Background Information
Full Name
pre-mRNA processing factor 4

PRPF4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PRPF4 cDNA ORF Clone in Cloning Vector, Rat RG80924-U
PRPF4 cDNA ORF Clone, Rat, untagged RG80924-UT
PRPF4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80924-ACG
PRPF4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80924-ACGLN
PRPF4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80924-ANG
PRPF4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80924-ACR
PRPF4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80924-ANR
PRPF4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80924-CF
PRPF4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80924-NF
PRPF4 cDNA ORF Clone, Rat, C-His tag RG80924-CH
PRPF4 cDNA ORF Clone, Rat, N-His tag RG80924-NH
PRPF4 cDNA ORF Clone, Rat, C-HA tag RG80924-CY
PRPF4 cDNA ORF Clone, Rat, N-HA tag RG80924-NY
PRPF4 cDNA ORF Clone, Rat, C-Myc tag RG80924-CM
PRPF4 qPCR Primer Pairs, Rat RP300888

PRPF4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRPF4 cDNA ORF Clone in Cloning Vector, Mouse MG53971-U
PRPF4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53971-ACGLN

PRPF4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRPF4 cDNA ORF Clone in Cloning Vector, Human HG19672-U
PRPF4 cDNA ORF Clone, Human, untagged HG19672-UT
PRPF4 cDNA ORF Clone, Human, C-GFPSpark® tag HG19672-ACG
PRPF4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19672-ACGLN
PRPF4 cDNA ORF Clone, Human, N-GFPSpark® tag HG19672-ANG
PRPF4 cDNA ORF Clone, Human, C-OFPSpark® tag HG19672-ACR
PRPF4 cDNA ORF Clone, Human, N-OFPSpark® tag HG19672-ANR
PRPF4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19672-CF
PRPF4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19672-NF
PRPF4 cDNA ORF Clone, Human, C-His tag HG19672-CH
PRPF4 cDNA ORF Clone, Human, N-His tag HG19672-NH
PRPF4 cDNA ORF Clone, Human, C-HA tag HG19672-CY
PRPF4 cDNA ORF Clone, Human, N-HA tag HG19672-NY
PRPF4 cDNA ORF Clone, Human, C-Myc tag HG19672-CM
PRPF4 cDNA ORF Clone, Human, N-Myc tag HG19672-NM
info info
添加购物车成功! 添加购物车失败!