PRMT5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81264-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRMT5 Reagents
CRO Services
Product recommended

All PRMT5 Reagents
PRMT5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1914 bp
Description
Full length Clone DNA of Rat protein arginine methyltransferase 5 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRMT5 Background Information

Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. Protein arginine methyltransferase 5 (PRMT5) is a member of the protein arginine N-methyltransferases (PRMT)family, and exists as at least homodimers and homotetramers, or homooligomers mediated by disulfide bonds and non-covalent association ubiquitously. PRMT5 specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3), and thus plays a role in the assembly and biogenesis of snRNP core particles. PRMT5 methylates histone H2A and H4 'Arg-3' during germ cell development, as well as histone H3 'Arg-8', which may repress transcription. PRMT5 also methylates SUPT5H and regulates its transcriptional elongation properties. Additionally, it is also suggested that PRMT5 negatively regulates cyclin E1 promoter activity and cellular proliferation.

Full Name
protein arginine methyltransferase 5
References
  • Rho. J. et al., 2001, J.Biol. Chem. 276: 11393-11401.
  • Fabbrizio, E.et al., 2002, EMBO.Rep. 3: 641-645.
  • Azzouz, T.N. et al., 2005, J.Biol. Chem. 280: 34435-34440.
  • Pal, S., et al., 2004, Mol. Cell. Biol. 24:9630-9645.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • PRMT5 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PRMT5 cDNA ORF Clone in Cloning Vector, Rat RG81264-U
    PRMT5 cDNA ORF Clone, Rat, untagged RG81264-UT
    PRMT5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81264-ACGLN
    PRMT5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81264-ACG
    PRMT5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81264-ANG
    PRMT5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81264-ACR
    PRMT5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81264-ANR
    PRMT5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81264-NF
    PRMT5 cDNA ORF Clone, Rat, C-His tag RG81264-CH
    PRMT5 cDNA ORF Clone, Rat, N-His tag RG81264-NH
    PRMT5 cDNA ORF Clone, Rat, C-HA tag RG81264-CY
    PRMT5 cDNA ORF Clone, Rat, N-HA tag RG81264-NY
    PRMT5 cDNA ORF Clone, Rat, C-Myc tag RG81264-CM
    PRMT5 cDNA ORF Clone, Rat, N-Myc tag RG81264-NM
    PRMT5 qPCR Primer Pairs, Rat RP301220

    PRMT5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PRMT5 cDNA ORF Clone in Cloning Vector, Mouse MG50936-G
    PRMT5 cDNA ORF Clone, Mouse, untagged MG50936-UT
    PRMT5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50936-ACG
    PRMT5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50936-ACGLN
    PRMT5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50936-ANG
    PRMT5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50936-ACR
    PRMT5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50936-ANR
    PRMT5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50936-CF
    PRMT5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50936-NF
    PRMT5 cDNA ORF Clone, Mouse, C-His tag MG50936-CH
    PRMT5 cDNA ORF Clone, Mouse, N-His tag MG50936-NH
    PRMT5 cDNA ORF Clone, Mouse, C-HA tag MG50936-CY
    PRMT5 cDNA ORF Clone, Mouse, N-HA tag MG50936-NY
    PRMT5 cDNA ORF Clone, Mouse, C-Myc tag MG50936-CM
    PRMT5 cDNA ORF Clone, Mouse, N-Myc tag MG50936-NM
    PRMT5 qPCR Primer Pairs, Mouse MP200905

    PRMT5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PRMT5 cDNA ORF Clone in Cloning Vector, Human HG11074-M
    PRMT5 cDNA ORF Clone, Human, untagged HG11074-UT
    PRMT5 cDNA ORF Clone, Human, C-GFPSpark® tag HG11074-ACG
    PRMT5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11074-ACGLN
    PRMT5 cDNA ORF Clone, Human, N-GFPSpark® tag HG11074-ANG
    PRMT5 cDNA ORF Clone, Human, C-OFPSpark® tag HG11074-ACR
    PRMT5 cDNA ORF Clone, Human, N-OFPSpark® tag HG11074-ANR
    PRMT5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11074-CF
    PRMT5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11074-NF
    PRMT5 cDNA ORF Clone, Human, C-His tag HG11074-CH
    PRMT5 cDNA ORF Clone, Human, N-His tag HG11074-NH
    PRMT5 cDNA ORF Clone, Human, C-HA tag HG11074-CY
    PRMT5 cDNA ORF Clone, Human, N-HA tag HG11074-NY
    PRMT5 cDNA ORF Clone, Human, C-Myc tag HG11074-CM
    PRMT5 cDNA ORF Clone, Human, N-Myc tag HG11074-NM
    PRMT5 qPCR Primer Pairs, Human HP100849
    info info
    添加购物车成功! 添加购物车失败!