Quick Order

Text Size:AAA

Rat PRMT5/SKB1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat PRMT5 cDNA Clone Product Information
NCBI RefSeq:NM_001108867.2
RefSeq ORF Size:1914bp
cDNA Description:Full length Clone DNA of Rattus norvegicus protein arginine methyltransferase 5.
Gene Synonym:Skb1
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. Protein arginine methyltransferase 5 (PRMT5) is a member of the protein arginine N-methyltransferases (PRMT)family, and exists as at least homodimers and homotetramers, or homooligomers mediated by disulfide bonds and non-covalent association ubiquitously. PRMT5 specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3), and thus plays a role in the assembly and biogenesis of snRNP core particles. PRMT5 methylates histone H2A and H4 'Arg-3' during germ cell development, as well as histone H3 'Arg-8', which may repress transcription. PRMT5 also methylates SUPT5H and regulates its transcriptional elongation properties. Additionally, it is also suggested that PRMT5 negatively regulates cyclin E1 promoter activity and cellular proliferation.

References
  • Rho. J. et al., 2001, J.Biol. Chem. 276: 11393-11401.
  • Fabbrizio, E.et al., 2002, EMBO.Rep. 3: 641-645.
  • Azzouz, T.N. et al., 2005, J.Biol. Chem. 280: 34435-34440.
  • Pal, S., et al., 2004, Mol. Cell. Biol. 24:9630-9645.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • Size / Price
    Catalog: RG81264-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"