Peroxiredoxin 1 cDNA ORF Clone, Rat, C-His tag

Cat: RG80520-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Peroxiredoxin 1 Reagents
CRO Services
Product recommended

All Peroxiredoxin 1 Reagents
Peroxiredoxin 1 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
600 bp
Description
Full length Clone DNA of Rat peroxiredoxin 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Peroxiredoxin 1 Background Information

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

Full Name
peroxiredoxin 1
References
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Peroxiredoxin 1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 1 cDNA ORF Clone in Cloning Vector, Rat RG80520-U
    Peroxiredoxin 1 cDNA ORF Clone, Rat, untagged RG80520-UT
    Peroxiredoxin 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80520-ACG
    Peroxiredoxin 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80520-ACGLN
    Peroxiredoxin 1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80520-ANG
    Peroxiredoxin 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80520-ACR
    Peroxiredoxin 1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80520-ANR
    Peroxiredoxin 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80520-CF
    Peroxiredoxin 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80520-NF
    Peroxiredoxin 1 cDNA ORF Clone, Rat, N-His tag RG80520-NH
    Peroxiredoxin 1 cDNA ORF Clone, Rat, C-HA tag RG80520-CY
    Peroxiredoxin 1 cDNA ORF Clone, Rat, N-HA tag RG80520-NY
    Peroxiredoxin 1 cDNA ORF Clone, Rat, C-Myc tag RG80520-CM
    Peroxiredoxin 1 cDNA ORF Clone, Rat, N-Myc tag RG80520-NM
    Peroxiredoxin 1 qPCR Primer Pairs, Rat RP300484

    Peroxiredoxin 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 1 cDNA ORF Clone in Cloning Vector, Mouse MG50552-M
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, untagged MG50552-UT
    Peroxiredoxin 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50552-ACGLN
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50552-ACG
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50552-ANG
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50552-ACR
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50552-ANR
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50552-CF
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50552-NF
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, C-His tag MG50552-CH
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, N-His tag MG50552-NH
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, C-HA tag MG50552-CY
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, N-HA tag MG50552-NY
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, C-Myc tag MG50552-CM
    Peroxiredoxin 1 cDNA ORF Clone, Mouse, N-Myc tag MG50552-NM
    Peroxiredoxin 1 qPCR Primer Pairs, Mouse MP200544

    Peroxiredoxin 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 1 cDNA ORF Clone in Cloning Vector, Human HG11194-M
    Peroxiredoxin 1 cDNA ORF Clone, Human, untagged HG11194-UT
    Peroxiredoxin 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11194-ACG
    Peroxiredoxin 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11194-ACGLN
    Peroxiredoxin 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11194-ANG
    Peroxiredoxin 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11194-ACR
    Peroxiredoxin 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11194-ANR
    Peroxiredoxin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11194-CF
    Peroxiredoxin 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11194-NF
    Peroxiredoxin 1 cDNA ORF Clone, Human, C-His tag HG11194-CH
    Peroxiredoxin 1 cDNA ORF Clone, Human, N-His tag HG11194-NH
    Peroxiredoxin 1 cDNA ORF Clone, Human, C-HA tag HG11194-CY
    Peroxiredoxin 1 cDNA ORF Clone, Human, N-HA tag HG11194-NY
    Peroxiredoxin 1 cDNA ORF Clone, Human, C-Myc tag HG11194-CM
    Peroxiredoxin 1 cDNA ORF Clone, Human, N-Myc tag HG11194-NM
    Peroxiredoxin 1 qPCR Primer Pairs, Human HP101099
    info info
    添加购物车成功! 添加购物车失败!