PQBP1 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81266-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PQBP1 Reagents
CRO Services
Product recommended

All PQBP1 Reagents
PQBP1 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Rat polyglutamine binding protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PQBP1 Background Information
Full Name
polyglutamine binding protein 1

PQBP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PQBP1 cDNA ORF Clone in Cloning Vector, Rat RG81266-U
PQBP1 cDNA ORF Clone, Rat, untagged RG81266-UT
PQBP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81266-ACGLN
PQBP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81266-ACG
PQBP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81266-ANG
PQBP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81266-ACR
PQBP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81266-ANR
PQBP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81266-CF
PQBP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81266-NF
PQBP1 cDNA ORF Clone, Rat, C-His tag RG81266-CH
PQBP1 cDNA ORF Clone, Rat, N-His tag RG81266-NH
PQBP1 cDNA ORF Clone, Rat, C-HA tag RG81266-CY
PQBP1 cDNA ORF Clone, Rat, N-HA tag RG81266-NY
PQBP1 cDNA ORF Clone, Rat, N-Myc tag RG81266-NM
PQBP1 qPCR Primer Pairs, Rat RP301222

PQBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PQBP1 cDNA ORF Clone in Cloning Vector, Mouse MG5A0872-U
PQBP1 cDNA ORF Clone, Mouse, untagged MG5A0872-UT
PQBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0872-ACGLN
PQBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0872-ACG
PQBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0872-ANG
PQBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0872-ACR
PQBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0872-ANR
PQBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0872-CF
PQBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0872-NF
PQBP1 cDNA ORF Clone, Mouse, C-His tag MG5A0872-CH
PQBP1 cDNA ORF Clone, Mouse, N-His tag MG5A0872-NH
PQBP1 cDNA ORF Clone, Mouse, C-HA tag MG5A0872-CY
PQBP1 cDNA ORF Clone, Mouse, N-HA tag MG5A0872-NY
PQBP1 cDNA ORF Clone, Mouse, C-Myc tag MG5A0872-CM
PQBP1 cDNA ORF Clone, Mouse, N-Myc tag MG5A0872-NM

PQBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PQBP1 cDNA ORF Clone in Cloning Vector, Human HG15524-G
PQBP1 cDNA ORF Clone, Human, untagged HG15524-UT
PQBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15524-ACGLN
PQBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15524-ACG
PQBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15524-ANG
PQBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15524-ACR
PQBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15524-ANR
PQBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15524-CF
PQBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15524-NF
PQBP1 cDNA ORF Clone, Human, C-His tag HG15524-CH
PQBP1 cDNA ORF Clone, Human, N-His tag HG15524-NH
PQBP1 cDNA ORF Clone, Human, C-HA tag HG15524-CY
PQBP1 cDNA ORF Clone, Human, N-HA tag HG15524-NY
PQBP1 cDNA ORF Clone, Human, C-Myc tag HG15524-CM
PQBP1 cDNA ORF Clone, Human, N-Myc tag HG15524-NM
PQBP1 qPCR Primer Pairs, Human HP104146
info info
添加购物车成功! 添加购物车失败!