Quick Order

Rat PPP2R1A Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat PPP2R1A cDNA Clone Product Information
NCBI RefSeq:NM_057140.1
RefSeq ORF Size:1770bp
cDNA Description:Full length Clone DNA of Rattus norvegicus protein phosphatase 2, regulatory subunit A, alpha.
Gene Synonym:PR65
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PPP2R1A qPCR primers for gene expression analysis, RP300979 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: RG81015-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Add to CartBulk Discount Inquiry
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"