Quick Order

Rat PON3 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat PON3 cDNA Clone Product Information
NCBI RefSeq:NM_001004086.1
RefSeq ORF Size:1065bp
cDNA Description:Full length Clone DNA of Rattus norvegicus paraoxonase 3.
Gene Synonym:Pon3
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Draganov DI, et al. (2000) Rabbit serum paraoxonase 3 (PON3) is a high density lipoprotein-associated lactonase and protects low density lipoprotein against oxidation. J Biol Chem. 275(43): 33435-42.
  • Shih DM, et al. (2007) Decreased obesity and atherosclerosis in human paraoxonase 3 transgenic mice. Circ Res. 100(8): 1200-7.
  • Rosenblat M, et al. (2003) Mouse macrophage paraoxonase 2 activity is increased whereas cellular paraoxonase 3 activity is decreased under oxidative stress. Arterioscler Thromb Vasc Biol. 23(3): 468-74.
  • Size / Price
    Catalog: RG81169-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"