POLR1C cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81168-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All POLR1C Reagents
CRO Services
Product recommended

All POLR1C Reagents
POLR1C cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Rat polymerase (RNA) I polypeptide C with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

POLR1C cDNA ORF Clone, Rat, C-Myc tag Alternative Names
Ac2-127 cDNA ORF Clone, Rat;Rpo1-1 cDNA ORF Clone, Rat
POLR1C Background Information
Full Name
polymerase (RNA) I polypeptide C, 30kDa

POLR1C cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
POLR1C cDNA ORF Clone in Cloning Vector, Rat RG81168-U
POLR1C cDNA ORF Clone, Rat, untagged RG81168-UT
POLR1C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81168-ACGLN
POLR1C cDNA ORF Clone, Rat, C-GFPSpark® tag RG81168-ACG
POLR1C cDNA ORF Clone, Rat, N-GFPSpark® tag RG81168-ANG
POLR1C cDNA ORF Clone, Rat, C-OFPSpark® tag RG81168-ACR
POLR1C cDNA ORF Clone, Rat, N-OFPSpark® tag RG81168-ANR
POLR1C cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81168-CF
POLR1C cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81168-NF
POLR1C cDNA ORF Clone, Rat, C-His tag RG81168-CH
POLR1C cDNA ORF Clone, Rat, N-His tag RG81168-NH
POLR1C cDNA ORF Clone, Rat, C-HA tag RG81168-CY
POLR1C cDNA ORF Clone, Rat, N-HA tag RG81168-NY
POLR1C cDNA ORF Clone, Rat, N-Myc tag RG81168-NM
POLR1C qPCR Primer Pairs, Rat RP301124

POLR1C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
POLR1C cDNA ORF Clone in Cloning Vector, Mouse MG52359-U
POLR1C cDNA ORF Clone, Mouse, untagged MG52359-UT
POLR1C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52359-ACGLN
POLR1C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52359-ACG
POLR1C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52359-ANG
POLR1C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52359-ACR
POLR1C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52359-ANR
POLR1C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52359-CF
POLR1C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52359-NF
POLR1C cDNA ORF Clone, Mouse, C-His tag MG52359-CH
POLR1C cDNA ORF Clone, Mouse, N-His tag MG52359-NH
POLR1C cDNA ORF Clone, Mouse, C-HA tag MG52359-CY
POLR1C cDNA ORF Clone, Mouse, N-HA tag MG52359-NY
POLR1C cDNA ORF Clone, Mouse, C-Myc tag MG52359-CM
POLR1C cDNA ORF Clone, Mouse, N-Myc tag MG52359-NM
POLR1C qPCR Primer Pairs, Mouse MP202232

POLR1C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
POLR1C cDNA ORF Clone in Cloning Vector, Human HG20668-U
POLR1C cDNA ORF Clone, Human, untagged HG20668-UT
POLR1C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20668-ACGLN
POLR1C cDNA ORF Clone, Human, C-GFPSpark® tag HG20668-ACG
POLR1C cDNA ORF Clone, Human, N-GFPSpark® tag HG20668-ANG
POLR1C cDNA ORF Clone, Human, C-OFPSpark® tag HG20668-ACR
POLR1C cDNA ORF Clone, Human, N-OFPSpark® tag HG20668-ANR
POLR1C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20668-CF
POLR1C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20668-NF
POLR1C cDNA ORF Clone, Human, C-His tag HG20668-CH
POLR1C cDNA ORF Clone, Human, N-His tag HG20668-NH
POLR1C cDNA ORF Clone, Human, C-HA tag HG20668-CY
POLR1C cDNA ORF Clone, Human, N-HA tag HG20668-NY
POLR1C cDNA ORF Clone, Human, C-Myc tag HG20668-CM
POLR1C cDNA ORF Clone, Human, N-Myc tag HG20668-NM
info info
添加购物车成功! 添加购物车失败!