Quick Order

Rat PNLIPRP1 / PLRP1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Rat PNLIPRP1 cDNA Clone Product Information
NCBI RefSeq:NM_032081.1
RefSeq ORF Size:1422bp
cDNA Description:Full length Clone DNA of Rattus norvegicus pancreatic lipase-related protein 1 with N terminal HA tag.
Gene Synonym:Pnliprp1
Species:Rat
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PNLIPRP1, also known as PLRP1, belongs to the AB hydrolase superfamily, Lipase family. PNLIPRP1 is structurally similar to PLRP2. However, these two proteins display different functional properties. PNLIPRP1 may function as inhibitor of dietary triglyceride digestion. It lacks detectable lipase activity towards triglycerides, diglycerides, phosphatidylcholine, galactolipids or cholesterol esters. PLRP2 hydrolyses milk fat with a lower catalytic efficiency than that of PL. PLRP2 activity, higher on homogenized than on native milk fat, is differently influenced by fatty acids and colipase depending on a proteolytic cleavage in the lid domain.

References
  • Grupe A. et al., 2006, Am J Hum Genet. 78 (1): 78-88.
  • Strausberg RL. et al., 2002, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Giller T. et al., 1992, J Biol Chem. 267 (23): 16509-16.
  • Size / Price
    Catalog: RG80624-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"