PLP2 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81277-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PLP2 Reagents
CRO Services
Product recommended

All PLP2 Reagents
PLP2 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
456 bp
Description
Full length Clone DNA of Rat proteolipid protein 2 (colonic epithelium-enriched) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLP2 Background Information
Full Name
proteolipid protein 2 (colonic epithelium-enriched)

PLP2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PLP2 cDNA ORF Clone in Cloning Vector, Rat RG81277-U
PLP2 cDNA ORF Clone, Rat, untagged RG81277-UT
PLP2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81277-ACG
PLP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81277-ACGLN
PLP2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81277-ACR
PLP2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81277-CF
PLP2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81277-NF
PLP2 cDNA ORF Clone, Rat, C-His tag RG81277-CH
PLP2 cDNA ORF Clone, Rat, N-His tag RG81277-NH
PLP2 cDNA ORF Clone, Rat, C-HA tag RG81277-CY
PLP2 cDNA ORF Clone, Rat, N-HA tag RG81277-NY
PLP2 cDNA ORF Clone, Rat, N-Myc tag RG81277-NM
PLP2 qPCR Primer Pairs, Rat RP301233

PLP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PLP2 cDNA ORF Clone in Cloning Vector, Mouse MG5A1719-U
PLP2 cDNA ORF Clone, Mouse, untagged MG5A1719-UT
PLP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1719-ACG
PLP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1719-ACGLN
PLP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1719-ANG
PLP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1719-ACR
PLP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1719-ANR
PLP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1719-CF
PLP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1719-NF
PLP2 cDNA ORF Clone, Mouse, C-His tag MG5A1719-CH
PLP2 cDNA ORF Clone, Mouse, N-His tag MG5A1719-NH
PLP2 cDNA ORF Clone, Mouse, C-HA tag MG5A1719-CY
PLP2 cDNA ORF Clone, Mouse, N-HA tag MG5A1719-NY
PLP2 cDNA ORF Clone, Mouse, C-Myc tag MG5A1719-CM
PLP2 cDNA ORF Clone, Mouse, N-Myc tag MG5A1719-NM

PLP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLP2 cDNA ORF Clone in Cloning Vector, Human HG16300-G
PLP2 cDNA ORF Clone, Human, untagged HG16300-UT
PLP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16300-ACGLN
PLP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16300-ACG
PLP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16300-ACR
PLP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16300-CF
PLP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16300-NF
PLP2 cDNA ORF Clone, Human, C-His tag HG16300-CH
PLP2 cDNA ORF Clone, Human, N-His tag HG16300-NH
PLP2 cDNA ORF Clone, Human, C-HA tag HG16300-CY
PLP2 cDNA ORF Clone, Human, N-HA tag HG16300-NY
PLP2 cDNA ORF Clone, Human, C-Myc tag HG16300-CM
PLP2 cDNA ORF Clone, Human, N-Myc tag HG16300-NM
PLP2 qPCR Primer Pairs, Human HP105054
info info
添加购物车成功! 添加购物车失败!