Perilipin 3 cDNA ORF Clone, Rat, C-His tag

Cat: RG81094-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Perilipin 3 Reagents
CRO Services
Product recommended

All Perilipin 3 Reagents
Perilipin 3 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1317 bp
Description
Full length Clone DNA of Rat perilipin 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Perilipin 3 Background Information
Full Name
perilipin 3

Perilipin 3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Perilipin 3 cDNA ORF Clone in Cloning Vector, Rat RG81094-U
Perilipin 3 cDNA ORF Clone, Rat, untagged RG81094-UT
Perilipin 3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81094-ACGLN
Perilipin 3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81094-ACG
Perilipin 3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81094-ANG
Perilipin 3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81094-ACR
Perilipin 3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81094-ANR
Perilipin 3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81094-CF
Perilipin 3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81094-NF
Perilipin 3 cDNA ORF Clone, Rat, N-His tag RG81094-NH
Perilipin 3 cDNA ORF Clone, Rat, C-HA tag RG81094-CY
Perilipin 3 cDNA ORF Clone, Rat, N-HA tag RG81094-NY
Perilipin 3 cDNA ORF Clone, Rat, C-Myc tag RG81094-CM
Perilipin 3 cDNA ORF Clone, Rat, N-Myc tag RG81094-NM
Perilipin 3 qPCR Primer Pairs, Rat RP301051

Perilipin 3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Perilipin 3 cDNA ORF Clone in Cloning Vector, Mouse MG52422-U
Perilipin 3 cDNA ORF Clone, Mouse, untagged MG52422-UT
Perilipin 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52422-ACGLN
Perilipin 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52422-ACG
Perilipin 3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52422-ANG
Perilipin 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52422-ACR
Perilipin 3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52422-ANR
Perilipin 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52422-CF
Perilipin 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52422-NF
Perilipin 3 cDNA ORF Clone, Mouse, C-His tag MG52422-CH
Perilipin 3 cDNA ORF Clone, Mouse, N-His tag MG52422-NH
Perilipin 3 cDNA ORF Clone, Mouse, C-HA tag MG52422-CY
Perilipin 3 cDNA ORF Clone, Mouse, N-HA tag MG52422-NY
Perilipin 3 cDNA ORF Clone, Mouse, C-Myc tag MG52422-CM
Perilipin 3 cDNA ORF Clone, Mouse, N-Myc tag MG52422-NM
Perilipin 3 qPCR Primer Pairs, Mouse MP202295

Perilipin 3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Perilipin 3 cDNA ORF Clone in Cloning Vector, Human HG14091-G
Perilipin 3 cDNA ORF Clone, Human, untagged HG14091-UT
Perilipin 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14091-ACG
Perilipin 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14091-ACGLN
Perilipin 3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14091-ANG
Perilipin 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14091-ACR
Perilipin 3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14091-ANR
Perilipin 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14091-CF
Perilipin 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14091-NF
Perilipin 3 cDNA ORF Clone, Human, C-His tag HG14091-CH
Perilipin 3 cDNA ORF Clone, Human, N-His tag HG14091-NH
Perilipin 3 cDNA ORF Clone, Human, C-HA tag HG14091-CY
Perilipin 3 cDNA ORF Clone, Human, N-HA tag HG14091-NY
Perilipin 3 cDNA ORF Clone, Human, C-Myc tag HG14091-CM
Perilipin 3 cDNA ORF Clone, Human, N-Myc tag HG14091-NM
Perilipin 3 qPCR Primer Pairs, Human HP102744
info info
添加购物车成功! 添加购物车失败!