Urokinase / uPA cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81600-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Urokinase / uPA Reagents
CRO Services
Product recommended

All Urokinase / uPA Reagents
Urokinase / uPA cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1299 bp
Description
Full length Clone DNA of Rat plasminogen activator, urokinase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Urokinase / uPA Background Information

Plasminogen activator, urokinase, also known as PLAU and uPA, is a serine protease which converts plasminogen to plasmin, a broad-spectrum protease active on extracellular matrix (ECM) components. It is involved in complement activation, cell migration, wound healing, and generation of localized extracellular proteolysis during tissue remodelling, pro-hormone conversion, carcinogenesis and neoplasia. Like many components of the blood coagulation, fibrinolytic and complement cascades, uPA has a modular structure, including three conserved domains: a growth factor-like domain (GFD, residues 1-49), a kringle domain (residues 50-131), linked by an interdomain linker or "connecting peptide" (CP, residues 132-158) to the serine protease domain (residues 159-411). uPA and its receptor (uPAR) have been implicated in a broad spectrum of pathophysiological processes, including fibrinolysis, proteolysis, inflammation, atherogenesis and plaque destabilization, all of which are involved in the pathogenesis of MI (myocardial infarction). The role of uPA is not only linked to its action as an enzyme. In fact, the mere binding of uPA on the cell surface also brings about two events that broaden the spectrum of its biological functions: (1) a conformational change of the receptor, which, in turn, affects its interaction with other proteins; (2) a signal transduction which modulates the expression of apoptosis-related genes. Besides its applications as a thrombolytic agent and as a prognostic marker for tumors, uPA may provide the basis for other therapies, as the structure of the receptor-binding domain of uPA has become a model for the design of anti-cancer molecules. Because of the causal involvment of uPA in cancer invasion and metastasis, the blockade of uPA interactions and activity with specific inhibitors is of interest for novel strategies in cancer therapy.

Full Name
plasminogen activator, urokinase
References
  • Crippa MP. (2007) Urokinase-type plasminogen activator. Int J Biochem Cell Biol. 39(4): 690-4.
  • Kunamneni A, et al. (2008) Urokinase-a very popular cardiovascular agent. Recent Pat Cardiovasc Drug Discov. 3(1): 45-58.
  • Vincenza Carriero M, et al. (2009) Structure, function and antagonists of urokinase-type plasminogen activator. Front Biosci. 14: 3782-94.
  • Xu J, et al. (2010) Association of putative functional variants in the PLAU gene and the PLAUR gene with myocardial infarction. Clin Sci (Lond). 119(8): 353-9.
  • Urokinase / uPA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Urokinase / uPA cDNA ORF Clone in Cloning Vector, Rat RG81600-G
    Urokinase / uPA cDNA ORF Clone, Rat, untagged RG81600-UT
    Urokinase / uPA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81600-ACGLN
    Urokinase / uPA cDNA ORF Clone, Rat, C-GFPSpark® tag RG81600-ACG
    Urokinase / uPA cDNA ORF Clone, Rat, C-OFPSpark® tag RG81600-ACR
    Urokinase / uPA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81600-NF
    Urokinase / uPA cDNA ORF Clone, Rat, C-His tag RG81600-CH
    Urokinase / uPA cDNA ORF Clone, Rat, N-His tag RG81600-NH
    Urokinase / uPA cDNA ORF Clone, Rat, C-HA tag RG81600-CY
    Urokinase / uPA cDNA ORF Clone, Rat, N-HA tag RG81600-NY
    Urokinase / uPA cDNA ORF Clone, Rat, C-Myc tag RG81600-CM
    Urokinase / uPA cDNA ORF Clone, Rat, N-Myc tag RG81600-NM

    Urokinase / uPA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Urokinase / uPA cDNA ORF Clone, Mouse, untagged MG57130-UT
    Urokinase / uPA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57130-ACGLN

    Urokinase / uPA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Urokinase / uPA cDNA ORF Clone in Cloning Vector, Human HG10815-U
    Urokinase / uPA cDNA ORF Clone, Human, untagged HG10815-UT
    Urokinase / uPA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10815-ACGLN
    Urokinase / uPA cDNA ORF Clone, Human, C-GFPSpark® tag HG10815-ACG
    Urokinase / uPA cDNA ORF Clone, Human, C-OFPSpark® tag HG10815-ACR
    Urokinase / uPA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10815-CF
    Urokinase / uPA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10815-NF
    Urokinase / uPA cDNA ORF Clone, Human, C-His tag HG10815-CH
    Urokinase / uPA cDNA ORF Clone, Human, N-His tag HG10815-NH
    Urokinase / uPA cDNA ORF Clone, Human, C-HA tag HG10815-CY
    Urokinase / uPA cDNA ORF Clone, Human, N-HA tag HG10815-NY
    Urokinase / uPA cDNA ORF Clone, Human, C-Myc tag HG10815-CM
    Urokinase / uPA cDNA ORF Clone, Human, N-Myc tag HG10815-NM
    Urokinase / uPA qPCR Primer Pairs, Human HP100720
    info info
    添加购物车成功! 添加购物车失败!