PIN4 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80606-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PIN4 Reagents
CRO Services
Product recommended

All PIN4 Reagents
PIN4 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
396 bp
Description
Full length Clone DNA of Rat similar to Peptidyl-prolyl cis-trans isomerase NIMA-interacting 4 (Rotamase Pin4) (PPIase Pin4) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About PIN4
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PIN4 Background Information
Full Name
peptidylprolyl cis/trans isomerase, NIMA-interacting 4

PIN4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PIN4 cDNA ORF Clone in Cloning Vector, Rat RG80606-U
PIN4 cDNA ORF Clone, Rat, untagged RG80606-UT
PIN4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80606-ACG
PIN4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80606-ACGLN
PIN4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80606-ANG
PIN4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80606-ACR
PIN4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80606-ANR
PIN4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80606-CF
PIN4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80606-NF
PIN4 cDNA ORF Clone, Rat, C-His tag RG80606-CH
PIN4 cDNA ORF Clone, Rat, N-His tag RG80606-NH
PIN4 cDNA ORF Clone, Rat, N-HA tag RG80606-NY
PIN4 cDNA ORF Clone, Rat, C-Myc tag RG80606-CM
PIN4 cDNA ORF Clone, Rat, N-Myc tag RG80606-NM
PIN4 qPCR Primer Pairs, Rat RP300570

PIN4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PIN4 cDNA ORF Clone in Cloning Vector, Human HG15858-G
PIN4 cDNA ORF Clone, Human, untagged HG15858-UT
PIN4 cDNA ORF Clone, Human, C-GFPSpark® tag HG15858-ACG
PIN4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15858-ACGLN
PIN4 cDNA ORF Clone, Human, N-GFPSpark® tag HG15858-ANG
PIN4 cDNA ORF Clone, Human, C-OFPSpark® tag HG15858-ACR
PIN4 cDNA ORF Clone, Human, N-OFPSpark® tag HG15858-ANR
PIN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15858-CF
PIN4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15858-NF
PIN4 cDNA ORF Clone, Human, C-His tag HG15858-CH
PIN4 cDNA ORF Clone, Human, N-His tag HG15858-NH
PIN4 cDNA ORF Clone, Human, C-HA tag HG15858-CY
PIN4 cDNA ORF Clone, Human, N-HA tag HG15858-NY
PIN4 cDNA ORF Clone, Human, C-Myc tag HG15858-CM
PIN4 cDNA ORF Clone, Human, N-Myc tag HG15858-NM
PIN4 qPCR Primer Pairs, Human HP104449
info info
添加购物车成功! 添加购物车失败!