PDGFRA cDNA ORF Clone, Rat, N-HA tag

Cat: RG80433-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PDGFRA Reagents
CRO Services
Product recommended

All PDGFRA Reagents
PDGFRA cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3267 bp
Description
Full length Clone DNA of Rat platelet derived growth factor receptor, alpha polypeptide with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGFRA Background Information

PDGFRA, also known as CD140a, together with the structurally homolog protein PDGFRB (CD140b), are cell surface receptors for members of the platelet-derived growth factor family. They are members of the class III subfamily of receptor tyrosine kinase (RTKs) with the similar structure characteristics of five immunoglobulin-like domains in their extracellular region and a split kinase domain in their intracellular region. PDGFRA is expressed in oligodendrocyte progenitor cells and mesothelial cell, and binds all three ligand isoforms PDGF-AA, PDGF-BB and PDGF-AB with high affinity, whereas PDGFRB dose not bind PDGF-AA. PDGFRA plays an essential role in regulating proliferation, chemotaxis and migration of mesangial cells. Recent studies have indicated that PDGFRA acts as a critical mediator of signaling in testis organogenesis and Leydig cell differentiation, and in addition, particularly important for kidney development. Additionally, PDGFRA is involved in tumor angiogenesis and maintenance of the tumor microenvironment and has been implicated in development and metastasis of Hepatocellular carcinoma (HCC). PDGFRA may represent a potential therapeutic target in thymic tumours. PDGFRA gene amplification rather than gene mutation may be the underlying genetic mechanism driving PDGFRA overexpression in a portion of gliomas.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
platelet-derived growth factor receptor, alpha polypeptide
References
  • Oseini AM, et al. (2009) PDGFRalpha: a new therapeutic target in the treatment of hepatocellular carcinoma? Expert Opin Ther Targets. 13(4): 443-54.
  • Meister M, et al. (2009) Expression and mutational status of PDGFR in thymic tumours. Anticancer Res. 29(10): 4057-61.
  • Martinho O, et al. (2009) Expression, mutation and copy number analysis of platelet-derived growth factor receptor A (PDGFRA) and its ligand PDGFA in gliomas. Br J Cancer. 101(6): 973-82.
  • PDGFRA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PDGFRA cDNA ORF Clone in Cloning Vector, Rat RG80433-G
    PDGFRA cDNA ORF Clone, Rat, untagged RG80433-UT
    PDGFRA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80433-ACG
    PDGFRA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80433-ACGLN
    PDGFRA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80433-ACR
    PDGFRA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80433-CF
    PDGFRA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80433-NF
    PDGFRA cDNA ORF Clone, Rat, C-His tag RG80433-CH
    PDGFRA cDNA ORF Clone, Rat, N-His tag RG80433-NH
    PDGFRA cDNA ORF Clone, Rat, C-HA tag RG80433-CY
    PDGFRA cDNA ORF Clone, Rat, C-Myc tag RG80433-CM
    PDGFRA cDNA ORF Clone, Rat, N-Myc tag RG80433-NM
    PDGFRA qPCR Primer Pairs, Rat RP300406

    PDGFRA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PDGFRA cDNA ORF Clone in Cloning Vector, Human HG10556-M
    PDGFRA cDNA ORF Clone, Human, untagged HG10556-UT
    PDGFRA cDNA ORF Clone, Human, C-GFPSpark® tag HG10556-ACG
    PDGFRA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10556-ACGLN
    PDGFRA cDNA ORF Clone, Human, C-OFPSpark® tag HG10556-ACR
    PDGFRA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10556-CF
    PDGFRA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10556-NF
    PDGFRA cDNA ORF Clone, Human, C-His tag HG10556-CH
    PDGFRA cDNA ORF Clone, Human, N-His tag HG10556-NH
    PDGFRA cDNA ORF Clone, Human, C-HA tag HG10556-CY
    PDGFRA cDNA ORF Clone, Human, N-HA tag HG10556-NY
    PDGFRA cDNA ORF Clone, Human, C-Myc tag HG10556-CM
    PDGFRA cDNA ORF Clone, Human, N-Myc tag HG10556-NM
    PDGFRA qPCR Primer Pairs, Human HP100568
    info info
    添加购物车成功! 添加购物车失败!