PCOLCE cDNA ORF Clone, Rat, N-His tag

Cat: RG80617-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PCOLCE Reagents
CRO Services
Product recommended

All PCOLCE Reagents
PCOLCE cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Description
Full length Clone DNA of Rat procollagen C-endopeptidase enhancer with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCOLCE cDNA ORF Clone, Rat, N-His tag Alternative Names
PCPE cDNA ORF Clone, Rat
PCOLCE Background Information
Full Name
procollagen C-endopeptidase enhancer

PCOLCE cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PCOLCE cDNA ORF Clone in Cloning Vector, Rat RG80617-U
PCOLCE cDNA ORF Clone, Rat, untagged RG80617-UT
PCOLCE cDNA ORF Clone, Rat, C-GFPSpark® tag RG80617-ACG
PCOLCE Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80617-ACGLN
PCOLCE cDNA ORF Clone, Rat, C-OFPSpark® tag RG80617-ACR
PCOLCE cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80617-CF
PCOLCE cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80617-NF
PCOLCE cDNA ORF Clone, Rat, C-His tag RG80617-CH
PCOLCE cDNA ORF Clone, Rat, C-HA tag RG80617-CY
PCOLCE cDNA ORF Clone, Rat, N-HA tag RG80617-NY
PCOLCE cDNA ORF Clone, Rat, C-Myc tag RG80617-CM
PCOLCE cDNA ORF Clone, Rat, N-Myc tag RG80617-NM
PCOLCE qPCR Primer Pairs, Rat RP300581

PCOLCE cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PCOLCE cDNA ORF Clone in Cloning Vector, Mouse MG51831-G
PCOLCE cDNA ORF Clone, Mouse, untagged MG51831-UT
PCOLCE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51831-ACG
PCOLCE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51831-ACGLN
PCOLCE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51831-ACR
PCOLCE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51831-CF
PCOLCE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51831-NF
PCOLCE cDNA ORF Clone, Mouse, C-His tag MG51831-CH
PCOLCE cDNA ORF Clone, Mouse, N-His tag MG51831-NH
PCOLCE cDNA ORF Clone, Mouse, C-HA tag MG51831-CY
PCOLCE cDNA ORF Clone, Mouse, N-HA tag MG51831-NY
PCOLCE cDNA ORF Clone, Mouse, C-Myc tag MG51831-CM
PCOLCE cDNA ORF Clone, Mouse, N-Myc tag MG51831-NM
PCOLCE qPCR Primer Pairs, Mouse MP201704

PCOLCE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PCOLCE cDNA ORF Clone in Cloning Vector, Human HG16585-U
PCOLCE cDNA ORF Clone, Human, untagged HG16585-UT
PCOLCE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16585-ACGLN
PCOLCE cDNA ORF Clone, Human, C-GFPSpark® tag HG16585-ACG
PCOLCE cDNA ORF Clone, Human, C-OFPSpark® tag HG16585-ACR
PCOLCE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16585-CF
PCOLCE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16585-NF
PCOLCE cDNA ORF Clone, Human, C-His tag HG16585-CH
PCOLCE cDNA ORF Clone, Human, N-His tag HG16585-NH
PCOLCE cDNA ORF Clone, Human, C-HA tag HG16585-CY
PCOLCE cDNA ORF Clone, Human, N-HA tag HG16585-NY
PCOLCE cDNA ORF Clone, Human, C-Myc tag HG16585-CM
PCOLCE cDNA ORF Clone, Human, N-Myc tag HG16585-NM
info info
添加购物车成功! 添加购物车失败!