PAICS cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81215-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PAICS Reagents
CRO Services
Product recommended

All PAICS Reagents
PAICS cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1278 bp
Description
Full length Clone DNA of Rat phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAICS Background Information
Full Name
phosphoribosylaminoimidazole carboxylase; phosphoribosylaminoimidazolesuccinocarboxamide synthase

PAICS cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PAICS cDNA ORF Clone in Cloning Vector, Rat RG81215-U
PAICS cDNA ORF Clone, Rat, untagged RG81215-UT
PAICS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81215-ACGLN
PAICS cDNA ORF Clone, Rat, C-GFPSpark® tag RG81215-ACG
PAICS cDNA ORF Clone, Rat, N-GFPSpark® tag RG81215-ANG
PAICS cDNA ORF Clone, Rat, C-OFPSpark® tag RG81215-ACR
PAICS cDNA ORF Clone, Rat, N-OFPSpark® tag RG81215-ANR
PAICS cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81215-NF
PAICS cDNA ORF Clone, Rat, C-His tag RG81215-CH
PAICS cDNA ORF Clone, Rat, N-His tag RG81215-NH
PAICS cDNA ORF Clone, Rat, C-HA tag RG81215-CY
PAICS cDNA ORF Clone, Rat, N-HA tag RG81215-NY
PAICS cDNA ORF Clone, Rat, C-Myc tag RG81215-CM
PAICS cDNA ORF Clone, Rat, N-Myc tag RG81215-NM
PAICS qPCR Primer Pairs, Rat RP301171

PAICS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PAICS cDNA ORF Clone in Cloning Vector, Mouse MG51929-U
PAICS cDNA ORF Clone, Mouse, untagged MG51929-UT
PAICS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51929-ACG
PAICS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51929-ACGLN
PAICS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51929-ANG
PAICS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51929-ACR
PAICS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51929-ANR
PAICS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51929-CF
PAICS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51929-NF
PAICS cDNA ORF Clone, Mouse, C-His tag MG51929-CH
PAICS cDNA ORF Clone, Mouse, N-His tag MG51929-NH
PAICS cDNA ORF Clone, Mouse, C-HA tag MG51929-CY
PAICS cDNA ORF Clone, Mouse, N-HA tag MG51929-NY
PAICS cDNA ORF Clone, Mouse, C-Myc tag MG51929-CM
PAICS cDNA ORF Clone, Mouse, N-Myc tag MG51929-NM
PAICS qPCR Primer Pairs, Mouse MP201802

PAICS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PAICS cDNA ORF Clone in Cloning Vector, Human HG16819-U
PAICS cDNA ORF Clone, Human, untagged HG16819-UT
PAICS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16819-ACGLN
PAICS cDNA ORF Clone, Human, C-GFPSpark® tag HG16819-ACG
PAICS cDNA ORF Clone, Human, N-GFPSpark® tag HG16819-ANG
PAICS cDNA ORF Clone, Human, C-OFPSpark® tag HG16819-ACR
PAICS cDNA ORF Clone, Human, N-OFPSpark® tag HG16819-ANR
PAICS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16819-CF
PAICS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16819-NF
PAICS cDNA ORF Clone, Human, C-His tag HG16819-CH
PAICS cDNA ORF Clone, Human, N-His tag HG16819-NH
PAICS cDNA ORF Clone, Human, C-HA tag HG16819-CY
PAICS cDNA ORF Clone, Human, N-HA tag HG16819-NY
PAICS cDNA ORF Clone, Human, C-Myc tag HG16819-CM
PAICS cDNA ORF Clone, Human, N-Myc tag HG16819-NM
info info
添加购物车成功! 添加购物车失败!