OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-His tag

Cat: RG80649-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OTC/Ornithine Carbamoyltransferase Reagents
CRO Services
Product recommended

All OTC/Ornithine Carbamoyltransferase Reagents
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Rat ornithine carbamoyltransferase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OTC/Ornithine Carbamoyltransferase Background Information
Full Name
ornithine carbamoyltransferase

OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone in Cloning Vector, Rat RG80649-U
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, untagged RG80649-UT
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-GFPSpark® tag RG80649-ACG
OTC/Ornithine Carbamoyltransferase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80649-ACGLN
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-GFPSpark® tag RG80649-ANG
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-OFPSpark® tag RG80649-ACR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-OFPSpark® tag RG80649-ANR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80649-CF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80649-NF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-His tag RG80649-CH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-HA tag RG80649-CY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-HA tag RG80649-NY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-Myc tag RG80649-CM
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-Myc tag RG80649-NM
OTC/Ornithine Carbamoyltransferase qPCR Primer Pairs, Rat RP300613

OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone in Cloning Vector, Mouse MG53756-U
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, untagged MG53756-UT
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53756-ACG
OTC/Ornithine Carbamoyltransferase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53756-ACGLN
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53756-ANG
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53756-ACR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53756-ANR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53756-CF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53756-NF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-His tag MG53756-CH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-His tag MG53756-NH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-HA tag MG53756-CY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-HA tag MG53756-NY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-Myc tag MG53756-CM
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-Myc tag MG53756-NM

OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone in Cloning Vector, Human HG12057-G
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, untagged HG12057-UT
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-GFPSpark® tag HG12057-ACG
OTC/Ornithine Carbamoyltransferase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12057-ACGLN
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-GFPSpark® tag HG12057-ANG
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-OFPSpark® tag HG12057-ACR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-OFPSpark® tag HG12057-ANR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12057-CF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12057-NF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-His tag HG12057-CH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-His tag HG12057-NH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-HA tag HG12057-CY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-HA tag HG12057-NY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-Myc tag HG12057-CM
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-Myc tag HG12057-NM
OTC/Ornithine Carbamoyltransferase qPCR Primer Pairs, Human HP101588
info info
添加购物车成功! 添加购物车失败!