OLA1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80915-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All OLA1 Reagents
CRO Services
Product recommended

All OLA1 Reagents
OLA1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Description
Full length Clone DNA of Rat Obg-like ATPase 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OLA1 Background Information
Full Name
Obg-like ATPase 1

OLA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
OLA1 cDNA ORF Clone in Cloning Vector, Rat RG80915-U
OLA1 cDNA ORF Clone, Rat, untagged RG80915-UT
OLA1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80915-ACGLN
OLA1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80915-ACG
OLA1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80915-ANG
OLA1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80915-ACR
OLA1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80915-ANR
OLA1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80915-CF
OLA1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80915-NF
OLA1 cDNA ORF Clone, Rat, C-His tag RG80915-CH
OLA1 cDNA ORF Clone, Rat, N-His tag RG80915-NH
OLA1 cDNA ORF Clone, Rat, C-HA tag RG80915-CY
OLA1 cDNA ORF Clone, Rat, N-HA tag RG80915-NY
OLA1 cDNA ORF Clone, Rat, C-Myc tag RG80915-CM
OLA1 qPCR Primer Pairs, Rat RP300879

OLA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OLA1 cDNA ORF Clone in Cloning Vector, Mouse MG51878-G
OLA1 cDNA ORF Clone, Mouse, untagged MG51878-UT
OLA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51878-ACG
OLA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51878-ACGLN
OLA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51878-ANG
OLA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51878-ACR
OLA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51878-ANR
OLA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51878-CF
OLA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51878-NF
OLA1 cDNA ORF Clone, Mouse, C-His tag MG51878-CH
OLA1 cDNA ORF Clone, Mouse, N-His tag MG51878-NH
OLA1 cDNA ORF Clone, Mouse, C-HA tag MG51878-CY
OLA1 cDNA ORF Clone, Mouse, N-HA tag MG51878-NY
OLA1 cDNA ORF Clone, Mouse, C-Myc tag MG51878-CM
OLA1 cDNA ORF Clone, Mouse, N-Myc tag MG51878-NM
OLA1 qPCR Primer Pairs, Mouse MP201751

OLA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OLA1 cDNA ORF Clone, Human, untagged HG20788-UT
info info
添加购物车成功! 添加购物车失败!