ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80779-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ODAM/Odontogenic ameloblast asssociated Reagents
CRO Services
Product recommended

All ODAM/Odontogenic ameloblast asssociated Reagents
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
837 bp
Description
Full length Clone DNA of Rat odontogenic, ameloblast asssociated with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ODAM/Odontogenic ameloblast asssociated Background Information
Full Name
odontogenic, ameloblast asssociated

ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone in Cloning Vector, Rat RG80779-U
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, untagged RG80779-UT
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, C-GFPSpark® tag RG80779-ACG
ODAM/Odontogenic ameloblast asssociated Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80779-ACGLN
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, C-OFPSpark® tag RG80779-ACR
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80779-CF
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80779-NF
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, C-His tag RG80779-CH
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, N-His tag RG80779-NH
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, C-HA tag RG80779-CY
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, N-HA tag RG80779-NY
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Rat, C-Myc tag RG80779-CM
ODAM/Odontogenic ameloblast asssociated qPCR Primer Pairs, Rat RP300743

ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone in Cloning Vector, Human HG13784-G
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, untagged HG13784-UT
ODAM/Odontogenic ameloblast asssociated Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13784-ACGLN
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, C-GFPSpark® tag HG13784-ACG
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, C-OFPSpark® tag HG13784-ACR
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13784-CF
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13784-NF
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, C-His tag HG13784-CH
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, N-His tag HG13784-NH
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, C-HA tag HG13784-CY
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, N-HA tag HG13784-NY
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, C-Myc tag HG13784-CM
ODAM/Odontogenic ameloblast asssociated cDNA ORF Clone, Human, N-Myc tag HG13784-NM
ODAM/Odontogenic ameloblast asssociated qPCR Primer Pairs, Human HP102459
info info
添加购物车成功! 添加购物车失败!