Quick Order

Rat ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Rat NUDT5 cDNA Clone Product Information
    NCBI RefSeq:NM_001007733.1
    RefSeq ORF Size:660bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus nudix (nucleoside diphosphate linked moiety X)-type motif 5.
    Gene Synonym:Nudt5
    Species:Rat
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NUDT5 qPCR primers for gene expression analysis, RP301066 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Rat ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid on other vectors
    Product nameProduct name
    Background

    ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

    References
  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • Size / Price
    Catalog: RG81109-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"