TrkA cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80404-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TrkA Reagents
CRO Services
Product recommended

All TrkA Reagents
TrkA cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2400 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1284C/T not causing the amino acid variation.
Description
Full length Clone DNA of Rat neurotrophic tyrosine kinase, receptor, type 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI(two restriction sites) + XbaI (6kb + 2.19kb + 0.21kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TrkA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TrkA cDNA ORF Clone, Rat, N-DDK (Flag®) tag Validated Images
Rat TrkA/NTRK1 Gene Plasmid Map 5940
TrkA Background Information

TRKA is a member of the neurotrophic tyrosine kinase receptor (NTKR) family. It is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Isoform TrkA-III promotes angiogenesis and has oncogenic activity when overexpressed. Isoform TrkA-I is found in most non-neuronal tissues. Isoform TrkA-II is primarily expressed in neuronal cells. TrkA-III is specifically expressed by pluripotent neural stem and neural crest progenitors. The presence of NTRK1 leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in TRKA gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. It was originally identified as an oncogene as it is commonly mutated in cancers, particularly colon and thyroid carcinomas. TRKA is required for high-affinity binding to nerve growth factor (NGF), neurotrophin-3 and neurotrophin-4/5 but not brain-derived neurotrophic factor (BDNF). Known substrates for the Trk receptors are SHC1, PI 3-kinase, and PLC-gamma-1. NTRK1 has a crucial role in the development and function of the nociceptive reception system as well as establishment of thermal regulation via sweating. It also activates ERK1 by either SHC1- or PLC-gamma-1-dependent signaling pathway. Defects in NTRK1 are a cause of congenital insensitivity to pain with anhidrosis and thyroid papillary carcinoma.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
neurotrophic tyrosine kinase, receptor, type 1
References
  • Lambiase A, et al. (2005) Molecular basis for keratoconus: lack of TrkA expression and its transcriptional repression by Sp3. Natl Acad Sci. 102 (46):16795-800.
  • Benito-Gutiérrez E, et al. (2006) Origin and evolution of the Trk family of neurotrophic receptors. Mol Cell Neurosci. 31(2):179-92.
  • Martin-Zanca D, et al. (1986) A human oncogene formed by the fusion of truncated tropomyosin and protein tyrosine kinase sequences. Nature. 319(6056):743-8.
  • TrkA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TrkA cDNA ORF Clone in Cloning Vector, Rat RG80404-G
    TrkA cDNA ORF Clone, Rat, untagged RG80404-UT
    TrkA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80404-ACG
    TrkA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80404-ACGLN
    TrkA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80404-ACR
    TrkA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80404-CF
    TrkA cDNA ORF Clone, Rat, C-His tag RG80404-CH
    TrkA cDNA ORF Clone, Rat, N-His tag RG80404-NH
    TrkA cDNA ORF Clone, Rat, C-HA tag RG80404-CY
    TrkA cDNA ORF Clone, Rat, N-HA tag RG80404-NY
    TrkA cDNA ORF Clone, Rat, C-Myc tag RG80404-CM
    TrkA cDNA ORF Clone, Rat, N-Myc tag RG80404-NM
    TrkA qPCR Primer Pairs, Rat RP300369

    TrkA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TrkA cDNA ORF Clone in Cloning Vector, Mouse MG51103-G
    TrkA cDNA ORF Clone, Mouse, untagged MG51103-UT
    TrkA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51103-ACG
    TrkA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51103-ACGLN
    TrkA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51103-ACR
    TrkA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51103-CF
    TrkA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51103-NF
    TrkA cDNA ORF Clone, Mouse, C-His tag MG51103-CH
    TrkA cDNA ORF Clone, Mouse, N-His tag MG51103-NH
    TrkA cDNA ORF Clone, Mouse, C-HA tag MG51103-CY
    TrkA cDNA ORF Clone, Mouse, N-HA tag MG51103-NY
    TrkA cDNA ORF Clone, Mouse, C-Myc tag MG51103-CM
    TrkA cDNA ORF Clone, Mouse, N-Myc tag MG51103-NM
    TrkA qPCR Primer Pairs, Mouse MP201056

    TrkA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TrkA cDNA ORF Clone in Cloning Vector, Human HG11073-M
    TrkA cDNA ORF Clone, Human, untagged HG11073-UT
    TrkA cDNA ORF Clone, Human, C-GFPSpark® tag HG11073-ACG
    TrkA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11073-ACGLN
    TrkA cDNA ORF Clone, Human, C-OFPSpark® tag HG11073-ACR
    TrkA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11073-CF
    TrkA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11073-NF
    TrkA cDNA ORF Clone, Human, C-His tag HG11073-CH
    TrkA cDNA ORF Clone, Human, N-His tag HG11073-NH
    TrkA cDNA ORF Clone, Human, C-HA tag HG11073-CY
    TrkA cDNA ORF Clone, Human, N-HA tag HG11073-NY
    TrkA cDNA ORF Clone, Human, C-Myc tag HG11073-CM
    TrkA cDNA ORF Clone, Human, N-Myc tag HG11073-NM
    TrkA qPCR Primer Pairs, Human HP100939
    info info
    添加购物车成功! 添加购物车失败!