After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat NTRK1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat NTRK1 cDNA Clone Product Information
NCBI RefSeq:NM_021589.1
RefSeq ORF Size:2400bp
cDNA Description:Full length Clone DNA of Rattus norvegicus neurotrophic tyrosine kinase, receptor, type 1.
Gene Synonym:Trk, Ntrk1
Species:Rat
Vector:pCMV3-untagged
Plasmid:pCMV3-ratNTRK1
Restriction Site:KpnI(two restriction sites) + XbaI (6.1kb + 2.2kb + 0.21kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1293 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Rat NTRK1 Gene Plasmid Map
Rat NTRK1 natural ORF mammalian expression plasmid
Product nameProduct name
Background

TRKA is a member of the neurotrophic tyrosine kinase receptor (NTKR) family. It is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Isoform TrkA-III promotes angiogenesis and has oncogenic activity when overexpressed. Isoform TrkA-I is found in most non-neuronal tissues. Isoform TrkA-II is primarily expressed in neuronal cells. TrkA-III is specifically expressed by pluripotent neural stem and neural crest progenitors. The presence of NTRK1 leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in TRKA gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. It was originally identified as an oncogene as it is commonly mutated in cancers, particularly colon and thyroid carcinomas. TRKA is required for high-affinity binding to nerve growth factor (NGF), neurotrophin-3 and neurotrophin-4/5 but not brain-derived neurotrophic factor (BDNF). Known substrates for the Trk receptors are SHC1, PI 3-kinase, and PLC-gamma-1. NTRK1 has a crucial role in the development and function of the nociceptive reception system as well as establishment of thermal regulation via sweating. It also activates ERK1 by either SHC1- or PLC-gamma-1-dependent signaling pathway. Defects in NTRK1 are a cause of congenital insensitivity to pain with anhidrosis and thyroid papillary carcinoma.

References
  • Lambiase A, et al. (2005) Molecular basis for keratoconus: lack of TrkA expression and its transcriptional repression by Sp3. Natl Acad Sci. 102 (46):16795-800.
  • Benito-Gutiérrez E, et al. (2006) Origin and evolution of the Trk family of neurotrophic receptors. Mol Cell Neurosci. 31(2):179-92.
  • Martin-Zanca D, et al. (1986) A human oncogene formed by the fusion of truncated tropomyosin and protein tyrosine kinase sequences. Nature. 319(6056):743-8.
  • Size / Price
    Catalog: RG80404-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"