After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat TrkA/NTRK1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Rat NTRK1 cDNA Clone Product Information
NCBI RefSeq:NM_021589.1
RefSeq ORF Size:2400bp
cDNA Description:Full length Clone DNA of Rattus norvegicus neurotrophic tyrosine kinase, receptor, type 1 with C terminal HA tag.
Gene Synonym:Trk, Ntrk1
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

TRKA is a member of the neurotrophic tyrosine kinase receptor (NTKR) family. It is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Isoform TrkA-III promotes angiogenesis and has oncogenic activity when overexpressed. Isoform TrkA-I is found in most non-neuronal tissues. Isoform TrkA-II is primarily expressed in neuronal cells. TrkA-III is specifically expressed by pluripotent neural stem and neural crest progenitors. The presence of NTRK1 leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in TRKA gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. It was originally identified as an oncogene as it is commonly mutated in cancers, particularly colon and thyroid carcinomas. TRKA is required for high-affinity binding to nerve growth factor (NGF), neurotrophin-3 and neurotrophin-4/5 but not brain-derived neurotrophic factor (BDNF). Known substrates for the Trk receptors are SHC1, PI 3-kinase, and PLC-gamma-1. NTRK1 has a crucial role in the development and function of the nociceptive reception system as well as establishment of thermal regulation via sweating. It also activates ERK1 by either SHC1- or PLC-gamma-1-dependent signaling pathway. Defects in NTRK1 are a cause of congenital insensitivity to pain with anhidrosis and thyroid papillary carcinoma.

References
  • Lambiase A, et al. (2005) Molecular basis for keratoconus: lack of TrkA expression and its transcriptional repression by Sp3. Natl Acad Sci. 102 (46):16795-800.
  • Benito-Gutiérrez E, et al. (2006) Origin and evolution of the Trk family of neurotrophic receptors. Mol Cell Neurosci. 31(2):179-92.
  • Martin-Zanca D, et al. (1986) A human oncogene formed by the fusion of truncated tropomyosin and protein tyrosine kinase sequences. Nature. 319(6056):743-8.
  • Size / Price
    Catalog: RG80404-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"