NSDHL cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80982-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NSDHL Reagents
CRO Services
Product recommended

All NSDHL Reagents
NSDHL cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1089 bp
Description
Full length Clone DNA of Rat NAD(P) dependent steroid dehydrogenase-like with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NSDHL Background Information
Full Name
NAD(P) dependent steroid dehydrogenase-like

NSDHL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NSDHL cDNA ORF Clone in Cloning Vector, Rat RG80982-U
NSDHL cDNA ORF Clone, Rat, untagged RG80982-UT
NSDHL cDNA ORF Clone, Rat, C-GFPSpark® tag RG80982-ACG
NSDHL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80982-ACGLN
NSDHL cDNA ORF Clone, Rat, N-GFPSpark® tag RG80982-ANG
NSDHL cDNA ORF Clone, Rat, C-OFPSpark® tag RG80982-ACR
NSDHL cDNA ORF Clone, Rat, N-OFPSpark® tag RG80982-ANR
NSDHL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80982-CF
NSDHL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80982-NF
NSDHL cDNA ORF Clone, Rat, C-His tag RG80982-CH
NSDHL cDNA ORF Clone, Rat, N-His tag RG80982-NH
NSDHL cDNA ORF Clone, Rat, C-HA tag RG80982-CY
NSDHL cDNA ORF Clone, Rat, N-HA tag RG80982-NY
NSDHL cDNA ORF Clone, Rat, C-Myc tag RG80982-CM
NSDHL qPCR Primer Pairs, Rat RP300946

NSDHL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NSDHL cDNA ORF Clone in Cloning Vector, Mouse MG51788-G
NSDHL cDNA ORF Clone, Mouse, untagged MG51788-UT
NSDHL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51788-ACGLN
NSDHL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51788-ACG
NSDHL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51788-ANG
NSDHL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51788-ACR
NSDHL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51788-ANR
NSDHL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51788-CF
NSDHL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51788-NF
NSDHL cDNA ORF Clone, Mouse, C-His tag MG51788-CH
NSDHL cDNA ORF Clone, Mouse, N-His tag MG51788-NH
NSDHL cDNA ORF Clone, Mouse, C-HA tag MG51788-CY
NSDHL cDNA ORF Clone, Mouse, N-HA tag MG51788-NY
NSDHL cDNA ORF Clone, Mouse, C-Myc tag MG51788-CM
NSDHL cDNA ORF Clone, Mouse, N-Myc tag MG51788-NM
NSDHL qPCR Primer Pairs, Mouse MP201661

NSDHL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NSDHL cDNA ORF Clone in Cloning Vector, Human HG14411-G
NSDHL cDNA ORF Clone, Human, untagged HG14411-UT
NSDHL cDNA ORF Clone, Human, C-GFPSpark® tag HG14411-ACG
NSDHL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14411-ACGLN
NSDHL cDNA ORF Clone, Human, N-GFPSpark® tag HG14411-ANG
NSDHL cDNA ORF Clone, Human, C-OFPSpark® tag HG14411-ACR
NSDHL cDNA ORF Clone, Human, N-OFPSpark® tag HG14411-ANR
NSDHL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14411-CF
NSDHL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14411-NF
NSDHL cDNA ORF Clone, Human, C-His tag HG14411-CH
NSDHL cDNA ORF Clone, Human, N-His tag HG14411-NH
NSDHL cDNA ORF Clone, Human, C-HA tag HG14411-CY
NSDHL cDNA ORF Clone, Human, N-HA tag HG14411-NY
NSDHL cDNA ORF Clone, Human, C-Myc tag HG14411-CM
NSDHL cDNA ORF Clone, Human, N-Myc tag HG14411-NM
NSDHL qPCR Primer Pairs, Human HP103060
info info
添加购物车成功! 添加购物车失败!