NIPSNAP3B cDNA ORF Clone, Rat, untagged

Cat: RG81220-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NIPSNAP3B Reagents
CRO Services
Product recommended

All NIPSNAP3B Reagents
NIPSNAP3B cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Rat nipsnap homolog 3B (C. elegans).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NIPSNAP3B Background Information
Full Name
nipsnap homolog 3B (C. elegans)

NIPSNAP3B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NIPSNAP3B cDNA ORF Clone in Cloning Vector, Rat RG81220-U
NIPSNAP3B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81220-ACGLN
NIPSNAP3B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81220-ACG
NIPSNAP3B cDNA ORF Clone, Rat, N-GFPSpark® tag RG81220-ANG
NIPSNAP3B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81220-ACR
NIPSNAP3B cDNA ORF Clone, Rat, N-OFPSpark® tag RG81220-ANR
NIPSNAP3B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81220-CF
NIPSNAP3B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81220-NF
NIPSNAP3B cDNA ORF Clone, Rat, C-His tag RG81220-CH
NIPSNAP3B cDNA ORF Clone, Rat, N-His tag RG81220-NH
NIPSNAP3B cDNA ORF Clone, Rat, C-HA tag RG81220-CY
NIPSNAP3B cDNA ORF Clone, Rat, N-HA tag RG81220-NY
NIPSNAP3B cDNA ORF Clone, Rat, C-Myc tag RG81220-CM
NIPSNAP3B cDNA ORF Clone, Rat, N-Myc tag RG81220-NM
NIPSNAP3B qPCR Primer Pairs, Rat RP301176

NIPSNAP3B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NIPSNAP3B cDNA ORF Clone in Cloning Vector, Mouse MG5A6088-U
NIPSNAP3B cDNA ORF Clone, Mouse, untagged MG5A6088-UT
NIPSNAP3B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6088-ACGLN
NIPSNAP3B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6088-ACG
NIPSNAP3B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6088-ANG
NIPSNAP3B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6088-ACR
NIPSNAP3B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6088-ANR
NIPSNAP3B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6088-CF
NIPSNAP3B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6088-NF
NIPSNAP3B cDNA ORF Clone, Mouse, C-His tag MG5A6088-CH
NIPSNAP3B cDNA ORF Clone, Mouse, N-His tag MG5A6088-NH
NIPSNAP3B cDNA ORF Clone, Mouse, C-HA tag MG5A6088-CY
NIPSNAP3B cDNA ORF Clone, Mouse, N-HA tag MG5A6088-NY
NIPSNAP3B cDNA ORF Clone, Mouse, C-Myc tag MG5A6088-CM
NIPSNAP3B cDNA ORF Clone, Mouse, N-Myc tag MG5A6088-NM
info info
添加购物车成功! 添加购物车失败!