Ninjurin-1 cDNA ORF Clone, Rat, N-His tag

Cat: RG80424-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ninjurin-1 Reagents
CRO Services
Product recommended

All Ninjurin-1 Reagents
Ninjurin-1 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Rat ninjurin 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ninjurin-1 Background Information

Ninjurin-1, also known as NINJ1, is a member of the Ninjurin family of transmembrane (TM) proteins. It is expressed in CD19(+) CD10(+) B-cell progenitor cells and higher levels in B-lineage acute lymphoblastic leukemia cells. Ninjurin-1 is expressed also in a number of other adult and embryonic tissues, predominantly in epithelial cells. Its expression is upregulated after axotomy in neurons and in Schwann cells surrounding the distal nerve segment. Upregulated expression of ninjurin-1 has been identified as a marker of minimal residual disease in B-lineage acute lymphoblastic leukemia. It mediates homophilic adhesion, and promotes neurite extension of dorsal root ganglion neurons in vitro. Ninjurin-1 has been found to show a high expression level in the liver tissue of patients with hepatocellular carcinoma, and this seems to be associated with cases of cirrhosis and chronic viral hepatitis. It has been reported that NINJURIN increases p21 expression and induces cellular senescence in human hepatoma cells.

Full Name
ninjurin 1
References
  • Cardoso CC, et al. (2007) Ninjurin 1 asp110ala single nucleotide polymorphism is associated with protection in leprosy nerve damage. J Neuroimmunol. 190 (1-2): 131-8.
  • Ifergan I, et al. (2011) Role of Ninjurin-1 in the migration of myeloid cells to central nervous system inflammatory lesions. Ann Neurol. 70 (5): 751-63.
  • Toyama T, et al. (2005) Ninjurin1 increases p21 expression and induces cellular senescence in human hepatoma cells. J Hepatol. 41 (4): 637-43.
  • Ninjurin-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ninjurin-1 cDNA ORF Clone in Cloning Vector, Rat RG80424-G
    Ninjurin-1 cDNA ORF Clone, Rat, untagged RG80424-UT
    Ninjurin-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80424-ACGLN
    Ninjurin-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80424-ACG
    Ninjurin-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80424-ACR
    Ninjurin-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80424-CF
    Ninjurin-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80424-NF
    Ninjurin-1 cDNA ORF Clone, Rat, C-His tag RG80424-CH
    Ninjurin-1 cDNA ORF Clone, Rat, C-HA tag RG80424-CY
    Ninjurin-1 cDNA ORF Clone, Rat, N-HA tag RG80424-NY
    Ninjurin-1 cDNA ORF Clone, Rat, C-Myc tag RG80424-CM
    Ninjurin-1 cDNA ORF Clone, Rat, N-Myc tag RG80424-NM
    Ninjurin-1 qPCR Primer Pairs, Rat RP300224

    Ninjurin-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ninjurin-1 cDNA ORF Clone in Cloning Vector, Mouse MG53796-U
    Ninjurin-1 cDNA ORF Clone, Mouse, untagged MG53796-UT
    Ninjurin-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53796-ACG
    Ninjurin-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53796-ACGLN
    Ninjurin-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53796-ACR
    Ninjurin-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53796-CF
    Ninjurin-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53796-NF
    Ninjurin-1 cDNA ORF Clone, Mouse, C-His tag MG53796-CH
    Ninjurin-1 cDNA ORF Clone, Mouse, N-His tag MG53796-NH
    Ninjurin-1 cDNA ORF Clone, Mouse, C-HA tag MG53796-CY
    Ninjurin-1 cDNA ORF Clone, Mouse, N-HA tag MG53796-NY
    Ninjurin-1 cDNA ORF Clone, Mouse, C-Myc tag MG53796-CM
    Ninjurin-1 cDNA ORF Clone, Mouse, N-Myc tag MG53796-NM

    Ninjurin-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ninjurin-1 cDNA ORF Clone in Cloning Vector, Human HG17094-U
    Ninjurin-1 cDNA ORF Clone, Human, untagged HG17094-UT
    Ninjurin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17094-ACGLN
    Ninjurin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17094-ACG
    Ninjurin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17094-ACR
    Ninjurin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17094-CF
    Ninjurin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17094-NF
    Ninjurin-1 cDNA ORF Clone, Human, C-His tag HG17094-CH
    Ninjurin-1 cDNA ORF Clone, Human, N-His tag HG17094-NH
    Ninjurin-1 cDNA ORF Clone, Human, C-HA tag HG17094-CY
    Ninjurin-1 cDNA ORF Clone, Human, N-HA tag HG17094-NY
    Ninjurin-1 cDNA ORF Clone, Human, C-Myc tag HG17094-CM
    Ninjurin-1 cDNA ORF Clone, Human, N-Myc tag HG17094-NM
    info info
    添加购物车成功! 添加购物车失败!