Text Size:AAA

Rat Ninjurin-1/NINJ1 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Rat NINJ1 cDNA Clone Product Information
    NCBI RefSeq:NM_012867.1
    RefSeq ORF Size:459bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus ninjurin 1 with N terminal Myc tag.
    Gene Synonym:Ninj1
    Species:Rat
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NINJ1 qPCR primers for gene expression analysis, RP300224 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Ninjurin-1, also known as NINJ1, is a member of the Ninjurin family of transmembrane (TM) proteins. It is expressed in CD19(+) CD10(+) B-cell progenitor cells and higher levels in B-lineage acute lymphoblastic leukemia cells. Ninjurin-1 is expressed also in a number of other adult and embryonic tissues, predominantly in epithelial cells. Its expression is upregulated after axotomy in neurons and in Schwann cells surrounding the distal nerve segment. Upregulated expression of ninjurin-1 has been identified as a marker of minimal residual disease in B-lineage acute lymphoblastic leukemia. It mediates homophilic adhesion, and promotes neurite extension of dorsal root ganglion neurons in vitro. Ninjurin-1 has been found to show a high expression level in the liver tissue of patients with hepatocellular carcinoma, and this seems to be associated with cases of cirrhosis and chronic viral hepatitis. It has been reported that NINJURIN increases p21 expression and induces cellular senescence in human hepatoma cells.

    References
  • Cardoso CC, et al. (2007) Ninjurin 1 asp110ala single nucleotide polymorphism is associated with protection in leprosy nerve damage. J Neuroimmunol. 190 (1-2): 131-8.
  • Ifergan I, et al. (2011) Role of Ninjurin-1 in the migration of myeloid cells to central nervous system inflammatory lesions. Ann Neurol. 70 (5): 751-63.
  • Toyama T, et al. (2005) Ninjurin1 increases p21 expression and induces cellular senescence in human hepatoma cells. J Hepatol. 41 (4): 637-43.
  • Size / Price
    Catalog: RG80424-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"