NHP2L1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81158-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NHP2L1 Reagents
CRO Services
Product recommended

All NHP2L1 Reagents
NHP2L1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
387 bp
Description
Full length Clone DNA of Rat NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NHP2L1 Background Information
Full Name
NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)

NHP2L1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
NHP2L1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90592-G
NHP2L1 cDNA ORF Clone, Cynomolgus, untagged CG90592-UT
NHP2L1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90592-ACGLN
NHP2L1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90592-ACG
NHP2L1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90592-ANG
NHP2L1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90592-ACR
NHP2L1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90592-ANR
NHP2L1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90592-CF
NHP2L1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90592-NF
NHP2L1 cDNA ORF Clone, Cynomolgus, C-His tag CG90592-CH
NHP2L1 cDNA ORF Clone, Cynomolgus, N-His tag CG90592-NH
NHP2L1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90592-CY
NHP2L1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90592-NY
NHP2L1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90592-CM
NHP2L1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90592-NM

NHP2L1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
NHP2L1 cDNA ORF Clone in Cloning Vector, Ferret FG60087-G
NHP2L1 cDNA ORF Clone, Ferret, untagged FG60087-UT
NHP2L1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60087-ACGLN
NHP2L1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60087-ACG
NHP2L1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60087-ANG
NHP2L1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60087-ACR
NHP2L1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60087-ANR
NHP2L1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60087-CF
NHP2L1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60087-NF
NHP2L1 cDNA ORF Clone, Ferret, C-His tag FG60087-CH
NHP2L1 cDNA ORF Clone, Ferret, N-His tag FG60087-NH
NHP2L1 cDNA ORF Clone, Ferret, C-HA tag FG60087-CY
NHP2L1 cDNA ORF Clone, Ferret, N-HA tag FG60087-NY
NHP2L1 cDNA ORF Clone, Ferret, C-Myc tag FG60087-CM
NHP2L1 cDNA ORF Clone, Ferret, N-Myc tag FG60087-NM

NHP2L1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NHP2L1 cDNA ORF Clone in Cloning Vector, Rat RG81158-U
NHP2L1 cDNA ORF Clone, Rat, untagged RG81158-UT
NHP2L1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81158-ACGLN
NHP2L1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81158-ACG
NHP2L1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81158-ANG
NHP2L1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81158-ACR
NHP2L1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81158-ANR
NHP2L1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81158-NF
NHP2L1 cDNA ORF Clone, Rat, C-His tag RG81158-CH
NHP2L1 cDNA ORF Clone, Rat, N-His tag RG81158-NH
NHP2L1 cDNA ORF Clone, Rat, C-HA tag RG81158-CY
NHP2L1 cDNA ORF Clone, Rat, N-HA tag RG81158-NY
NHP2L1 cDNA ORF Clone, Rat, C-Myc tag RG81158-CM
NHP2L1 cDNA ORF Clone, Rat, N-Myc tag RG81158-NM
NHP2L1 qPCR Primer Pairs, Rat RP301114

NHP2L1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NHP2L1 cDNA ORF Clone in Cloning Vector, Mouse MG53696-U
NHP2L1 cDNA ORF Clone, Mouse, untagged MG53696-UT
NHP2L1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53696-ACG
NHP2L1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53696-ACGLN
NHP2L1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53696-ANG
NHP2L1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53696-ACR
NHP2L1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53696-ANR
NHP2L1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53696-CF
NHP2L1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53696-NF
NHP2L1 cDNA ORF Clone, Mouse, C-His tag MG53696-CH
NHP2L1 cDNA ORF Clone, Mouse, N-His tag MG53696-NH
NHP2L1 cDNA ORF Clone, Mouse, C-HA tag MG53696-CY
NHP2L1 cDNA ORF Clone, Mouse, N-HA tag MG53696-NY
NHP2L1 cDNA ORF Clone, Mouse, C-Myc tag MG53696-CM
NHP2L1 cDNA ORF Clone, Mouse, N-Myc tag MG53696-NM

NHP2L1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NHP2L1 cDNA ORF Clone in Cloning Vector, Human HG20252-U
NHP2L1 cDNA ORF Clone, Human, untagged HG20252-UT
NHP2L1 cDNA ORF Clone, Human, C-GFPSpark® tag HG20252-ACG
NHP2L1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20252-ACGLN
NHP2L1 cDNA ORF Clone, Human, N-GFPSpark® tag HG20252-ANG
NHP2L1 cDNA ORF Clone, Human, C-OFPSpark® tag HG20252-ACR
NHP2L1 cDNA ORF Clone, Human, N-OFPSpark® tag HG20252-ANR
NHP2L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20252-CF
NHP2L1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20252-NF
NHP2L1 cDNA ORF Clone, Human, C-His tag HG20252-CH
NHP2L1 cDNA ORF Clone, Human, N-His tag HG20252-NH
NHP2L1 cDNA ORF Clone, Human, C-HA tag HG20252-CY
NHP2L1 cDNA ORF Clone, Human, N-HA tag HG20252-NY
NHP2L1 cDNA ORF Clone, Human, C-Myc tag HG20252-CM
NHP2L1 cDNA ORF Clone, Human, N-Myc tag HG20252-NM
info info
添加购物车成功! 添加购物车失败!