NDUFS2 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80523-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NDUFS2 Reagents
CRO Services
Product recommended

All NDUFS2 Reagents
NDUFS2 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1392 bp
Description
Full length Clone DNA of Rat NADH dehydrogenase (ubiquinone) Fe-S protein 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDUFS2 Background Information
Full Name
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)

NDUFS2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NDUFS2 cDNA ORF Clone in Cloning Vector, Rat RG80523-U
NDUFS2 cDNA ORF Clone, Rat, untagged RG80523-UT
NDUFS2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80523-ACG
NDUFS2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80523-ACGLN
NDUFS2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80523-ANG
NDUFS2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80523-ACR
NDUFS2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80523-ANR
NDUFS2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80523-CF
NDUFS2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80523-NF
NDUFS2 cDNA ORF Clone, Rat, C-His tag RG80523-CH
NDUFS2 cDNA ORF Clone, Rat, N-His tag RG80523-NH
NDUFS2 cDNA ORF Clone, Rat, N-HA tag RG80523-NY
NDUFS2 cDNA ORF Clone, Rat, C-Myc tag RG80523-CM
NDUFS2 cDNA ORF Clone, Rat, N-Myc tag RG80523-NM
NDUFS2 qPCR Primer Pairs, Rat RP300487

NDUFS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDUFS2 cDNA ORF Clone in Cloning Vector, Mouse MG51291-U
NDUFS2 cDNA ORF Clone, Mouse, untagged MG51291-UT
NDUFS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51291-ACG
NDUFS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51291-ACGLN
NDUFS2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51291-ANG
NDUFS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51291-ACR
NDUFS2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51291-ANR
NDUFS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51291-CF
NDUFS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51291-NF
NDUFS2 cDNA ORF Clone, Mouse, C-His tag MG51291-CH
NDUFS2 cDNA ORF Clone, Mouse, N-His tag MG51291-NH
NDUFS2 cDNA ORF Clone, Mouse, C-HA tag MG51291-CY
NDUFS2 cDNA ORF Clone, Mouse, N-HA tag MG51291-NY
NDUFS2 cDNA ORF Clone, Mouse, C-Myc tag MG51291-CM
NDUFS2 cDNA ORF Clone, Mouse, N-Myc tag MG51291-NM

NDUFS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDUFS2 cDNA ORF Clone in Cloning Vector, Human HG16895-U
NDUFS2 cDNA ORF Clone, Human, untagged HG16895-UT
NDUFS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16895-ACGLN
NDUFS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16895-ACG
NDUFS2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16895-ANG
NDUFS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16895-ACR
NDUFS2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16895-ANR
NDUFS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16895-CF
NDUFS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16895-NF
NDUFS2 cDNA ORF Clone, Human, C-His tag HG16895-CH
NDUFS2 cDNA ORF Clone, Human, N-His tag HG16895-NH
NDUFS2 cDNA ORF Clone, Human, C-HA tag HG16895-CY
NDUFS2 cDNA ORF Clone, Human, N-HA tag HG16895-NY
NDUFS2 cDNA ORF Clone, Human, C-Myc tag HG16895-CM
NDUFS2 cDNA ORF Clone, Human, N-Myc tag HG16895-NM
info info
添加购物车成功! 添加购物车失败!