Quick Order

Rat Nicastrin/NCSTN Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Rat NCSTN cDNA Clone Product Information
    NCBI RefSeq:NM_174864.3
    RefSeq ORF Size:2127bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus nicastrin.
    Gene Synonym:Ncstn
    Species:Rat
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NCSTN qPCR primers for gene expression analysis, RP301007 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    Nicastrin (NCST, or NCT), a single-pass membrane glycoprotein that harbors a large extracellular domain, is an essential component of the gamma-secretase complex. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes. Increasing evidences have shown that Nicastrin/NCSTN plays a crucial role in gamma-cleavage of the amyloid precursor protein (APP). The glycoprotein Nicastrin is an essential component of the gamma-secretase complex, a high molecular weight complex which also contains the presenilin proteins, Aph-1 and Pen-2. The gamma-secretase complex is not only involved in APP processing but also in the processing of an increasing number of other type I integral membrane proteins. As the largest subunit of the gamma-secretase complex, Nicastrin plays a crucial role in its activation. Inhibition of NCSTN demonstrated an altered gamma-cleavage activity, suggesting its potential implication in developing Alzheimer's disease (AD). In addition, Nicastrin can function to maintain epithelial to mesenchymal transition during breast cancer progression. Anti-nicastrin polyclonal and monoclonal antibodies were able to decrease notch1 and vimentin expression and reduced the invasive capacity of breast cancer cells in vitro.

    References
  • He G, et al. (2007) Degradation of nicastrin involves both proteasome and lysosome. J Neurochem. 101(4): 982-92.
  • Hayashi I, et al. (2009) Single chain variable fragment against nicastrin inhibits the gamma-secretase activity. J Biol Chem. 284(41): 27838-47.
  • Ma Z, et al. (2009) Association between promoter polymorphisms of the nicastrin gene and sporadic Alzheimer's disease in North Chinese Han population. Neurosci Lett. 458(3): 136-9.
  • Pardossi-Piquard R, et al. (2009) p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex. J Neurochem. 109(1): 225-37.
  • Filipovi? A, et al. (2011) Biological and clinical implications of nicastrin expression in invasive breast cancer. Breast Cancer Res Treat. 125(1): 43-53.
  • Size / Price
    Catalog: RG81043-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"