NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81189-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NANS/N-acetylneuraminic acid synthase Reagents
CRO Services
Product recommended

All NANS/N-acetylneuraminic acid synthase Reagents
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Rat N-acetylneuraminic acid synthase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NANS/N-acetylneuraminic acid synthase Background Information
Full Name
N-acetylneuraminic acid synthase

NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone in Cloning Vector, Rat RG81189-U
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, untagged RG81189-UT
NANS/N-acetylneuraminic acid synthase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81189-ACGLN
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, C-GFPSpark® tag RG81189-ACG
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, N-GFPSpark® tag RG81189-ANG
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, C-OFPSpark® tag RG81189-ACR
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, N-OFPSpark® tag RG81189-ANR
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81189-NF
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, C-His tag RG81189-CH
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, N-His tag RG81189-NH
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, C-HA tag RG81189-CY
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, N-HA tag RG81189-NY
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, C-Myc tag RG81189-CM
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Rat, N-Myc tag RG81189-NM
NANS/N-acetylneuraminic acid synthase qPCR Primer Pairs, Rat RP301145

NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone in Cloning Vector, Mouse MG53715-U
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, untagged MG53715-UT
NANS/N-acetylneuraminic acid synthase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53715-ACGLN
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53715-ACG
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53715-ANG
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53715-ACR
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53715-ANR
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53715-CF
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53715-NF
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, C-His tag MG53715-CH
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, N-His tag MG53715-NH
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, C-HA tag MG53715-CY
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, N-HA tag MG53715-NY
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, C-Myc tag MG53715-CM
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Mouse, N-Myc tag MG53715-NM

NANS/N-acetylneuraminic acid synthase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NANS/N-acetylneuraminic acid synthase cDNA ORF Clone in Cloning Vector, Human HG21599-U
info info
添加购物车成功! 添加购物车失败!