Quick Order

Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat NANS cDNA Clone Product Information
NCBI RefSeq:NM_001106655.2
RefSeq ORF Size:1080bp
cDNA Description:Full length Clone DNA of Rattus norvegicus N-acetylneuraminic acid synthase.
Gene Synonym:Nans
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid on other vectors
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagRG81189-ACG$225
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagRG81189-ACR$225
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagRG81189-ANG$225
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagRG81189-ANR$225
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, C-Flag tagRG81189-CF$195
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, C-His tagRG81189-CH$195
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, C-Myc tagRG81189-CM$195
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, C-HA tagRG81189-CY$195
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, N-Flag tagRG81189-NF$195
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, N-His tagRG81189-NH$195
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, N-Myc tagRG81189-NM$195
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmid, N-HA tagRG81189-NY$195
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone in cloning vectorRG81189-U$75
Rat NANS/N-acetylneuraminic acid synthase Gene ORF cDNA clone expression plasmidRG81189-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: RG81189-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"