MYL1 cDNA ORF Clone, Rat, C-His tag

Cat: RG80477-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MYL1 Reagents
CRO Services
Product recommended

All MYL1 Reagents
MYL1 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
453 bp
Description
Full length Clone DNA of Rat myosin, light chain 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MYL1 Background Information
Full Name
myosin, light chain 1, alkali; skeletal, fast

MYL1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MYL1 cDNA ORF Clone in Cloning Vector, Rat RG80477-U
MYL1 cDNA ORF Clone, Rat, untagged RG80477-UT
MYL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80477-ACGLN
MYL1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80477-ACG
MYL1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80477-ANG
MYL1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80477-ACR
MYL1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80477-ANR
MYL1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80477-CF
MYL1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80477-NF
MYL1 cDNA ORF Clone, Rat, N-His tag RG80477-NH
MYL1 cDNA ORF Clone, Rat, C-HA tag RG80477-CY
MYL1 cDNA ORF Clone, Rat, N-HA tag RG80477-NY
MYL1 cDNA ORF Clone, Rat, C-Myc tag RG80477-CM
MYL1 cDNA ORF Clone, Rat, N-Myc tag RG80477-NM
MYL1 qPCR Primer Pairs, Rat RP300441

MYL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MYL1 cDNA ORF Clone in Cloning Vector, Mouse MG52992-G
MYL1 cDNA ORF Clone, Mouse, untagged MG52992-UT
MYL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52992-ACG
MYL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52992-ACGLN
MYL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52992-ANG
MYL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52992-ACR
MYL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52992-ANR
MYL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52992-CF
MYL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52992-NF
MYL1 cDNA ORF Clone, Mouse, C-His tag MG52992-CH
MYL1 cDNA ORF Clone, Mouse, N-His tag MG52992-NH
MYL1 cDNA ORF Clone, Mouse, C-HA tag MG52992-CY
MYL1 cDNA ORF Clone, Mouse, N-HA tag MG52992-NY
MYL1 cDNA ORF Clone, Mouse, C-Myc tag MG52992-CM
MYL1 cDNA ORF Clone, Mouse, N-Myc tag MG52992-NM

MYL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MYL1 cDNA ORF Clone, Human, untagged HG20150-UT
info info
添加购物车成功! 添加购物车失败!