MTFR1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81603-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MTFR1 Reagents
CRO Services
Product recommended

All MTFR1 Reagents
MTFR1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Description
Full length Clone DNA of Rat mitochondrial fission regulator 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTFR1 Background Information
Full Name
mitochondrial fission regulator 1

MTFR1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MTFR1 cDNA ORF Clone in Cloning Vector, Rat RG81603-G
MTFR1 cDNA ORF Clone, Rat, untagged RG81603-UT
MTFR1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81603-ACG
MTFR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81603-ACGLN
MTFR1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81603-ANG
MTFR1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81603-ACR
MTFR1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81603-ANR
MTFR1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81603-NF
MTFR1 cDNA ORF Clone, Rat, C-His tag RG81603-CH
MTFR1 cDNA ORF Clone, Rat, N-His tag RG81603-NH
MTFR1 cDNA ORF Clone, Rat, C-HA tag RG81603-CY
MTFR1 cDNA ORF Clone, Rat, N-HA tag RG81603-NY
MTFR1 cDNA ORF Clone, Rat, C-Myc tag RG81603-CM
MTFR1 cDNA ORF Clone, Rat, N-Myc tag RG81603-NM

MTFR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTFR1 cDNA ORF Clone in Cloning Vector, Mouse MG53542-G
MTFR1 cDNA ORF Clone, Mouse, untagged MG53542-UT
MTFR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53542-ACG
MTFR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53542-ACGLN
MTFR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53542-ANG
MTFR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53542-ACR
MTFR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53542-ANR
MTFR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53542-CF
MTFR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53542-NF
MTFR1 cDNA ORF Clone, Mouse, C-His tag MG53542-CH
MTFR1 cDNA ORF Clone, Mouse, N-His tag MG53542-NH
MTFR1 cDNA ORF Clone, Mouse, C-HA tag MG53542-CY
MTFR1 cDNA ORF Clone, Mouse, N-HA tag MG53542-NY
MTFR1 cDNA ORF Clone, Mouse, C-Myc tag MG53542-CM
MTFR1 cDNA ORF Clone, Mouse, N-Myc tag MG53542-NM

MTFR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTFR1 cDNA ORF Clone in Cloning Vector, Human HG14724-G
MTFR1 cDNA ORF Clone, Human, untagged HG14724-UT
MTFR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14724-ACGLN
MTFR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14724-ACG
MTFR1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14724-ANG
MTFR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14724-ACR
MTFR1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14724-ANR
MTFR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14724-CF
MTFR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14724-NF
MTFR1 cDNA ORF Clone, Human, C-His tag HG14724-CH
MTFR1 cDNA ORF Clone, Human, N-His tag HG14724-NH
MTFR1 cDNA ORF Clone, Human, C-HA tag HG14724-CY
MTFR1 cDNA ORF Clone, Human, N-HA tag HG14724-NY
MTFR1 cDNA ORF Clone, Human, C-Myc tag HG14724-CM
MTFR1 cDNA ORF Clone, Human, N-Myc tag HG14724-NM
MTFR1 qPCR Primer Pairs, Human HP103357
info info
添加购物车成功! 添加购物车失败!