MTCH2 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80540-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MTCH2 Reagents
CRO Services
Product recommended

All MTCH2 Reagents
MTCH2 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
912 bp
Description
Full length Clone DNA of Rat mitochondrial carrier 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTCH2 Background Information
Full Name
mitochondrial carrier 2

MTCH2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MTCH2 cDNA ORF Clone in Cloning Vector, Rat RG80540-U
MTCH2 cDNA ORF Clone, Rat, untagged RG80540-UT
MTCH2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80540-ACG
MTCH2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80540-ACGLN
MTCH2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80540-ANG
MTCH2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80540-ACR
MTCH2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80540-ANR
MTCH2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80540-CF
MTCH2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80540-NF
MTCH2 cDNA ORF Clone, Rat, C-His tag RG80540-CH
MTCH2 cDNA ORF Clone, Rat, N-His tag RG80540-NH
MTCH2 cDNA ORF Clone, Rat, N-HA tag RG80540-NY
MTCH2 cDNA ORF Clone, Rat, C-Myc tag RG80540-CM
MTCH2 cDNA ORF Clone, Rat, N-Myc tag RG80540-NM
MTCH2 qPCR Primer Pairs, Rat RP300504

MTCH2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTCH2 cDNA ORF Clone in Cloning Vector, Human HG16436-U
MTCH2 cDNA ORF Clone, Human, untagged HG16436-UT
MTCH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16436-ACG
MTCH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16436-ACGLN
MTCH2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16436-ANG
MTCH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16436-ACR
MTCH2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16436-ANR
MTCH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16436-CF
MTCH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16436-NF
MTCH2 cDNA ORF Clone, Human, C-His tag HG16436-CH
MTCH2 cDNA ORF Clone, Human, N-His tag HG16436-NH
MTCH2 cDNA ORF Clone, Human, C-HA tag HG16436-CY
MTCH2 cDNA ORF Clone, Human, N-HA tag HG16436-NY
MTCH2 cDNA ORF Clone, Human, C-Myc tag HG16436-CM
MTCH2 cDNA ORF Clone, Human, N-Myc tag HG16436-NM
MTCH2 qPCR Primer Pairs, Human HP105184
info info
添加购物车成功! 添加购物车失败!