CD204 cDNA ORF Clone, Rat, C-His tag

Cat: RG80363-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD204 Reagents
CRO Services
Product recommended

All CD204 Reagents
CD204 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1365 bp
Description
Full length Clone DNA of Rat macrophage scavenger receptor 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD204 Background Information

Macrophage scavenger receptor types I and II, also known as Macrophage acetylated LDL receptor I and II, Scavenger receptor class A member 1, CD204, MSR1 and SCARA1, is a single-pass type I I membrane protein which contains one collagen-like domain and one SRCR domain. Macrophages are distributed in all peripheral tissues and play a critical role in the first line of the innate immune defenses against bacterial infection by phagocytosis of bacterial pathogens through the macrophage scavenger receptor 1 (MSR1). MSR1 / SCARA1 is one of the membrane glycoproteins implicated in the pathologic deposition of cholesterol in arterial walls during atherogenesis. Two types of receptor subunits exist. These receptors mediate the endocytosis of a diverse group of macromolecules, including modified low density lipoproteins (LDL). MSR1 / SCARA1 is also involved in chronic inflammation which is a risk factor for prostate cancer. MSR1 1 gene was identified as a candidate susceptibility gene for hereditary prostate cancer and as a risk factor for sporadic prostate cancer.

Full Name
macrophage scavenger receptor 1
References
  • Wang L. et al., 2003, Nat Genet. 35 (2): 128-9.
  • Chen Y.C. et al., 2008, Cancer Epidemiol Biomarkers Prev. 17 (4): 1001-3.
  • Shirato K. et al., 2009, Pflugers Arch. 459 (1): 93-103.
  • Sun J. et al., 2006, Prostate. 66 (7): 728-37.
  • CD204 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD204 cDNA ORF Clone in Cloning Vector, Rat RG80363-G
    CD204 cDNA ORF Clone, Rat, untagged RG80363-UT
    CD204 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80363-ACG
    CD204 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80363-ACGLN
    CD204 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80363-ACR
    CD204 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80363-CF
    CD204 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80363-NF
    CD204 cDNA ORF Clone, Rat, N-His tag RG80363-NH
    CD204 cDNA ORF Clone, Rat, C-HA tag RG80363-CY
    CD204 cDNA ORF Clone, Rat, N-HA tag RG80363-NY
    CD204 cDNA ORF Clone, Rat, C-Myc tag RG80363-CM
    CD204 cDNA ORF Clone, Rat, N-Myc tag RG80363-NM
    CD204 qPCR Primer Pairs, Rat RP300333

    CD204 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD204 cDNA ORF Clone in Cloning Vector, Mouse MG5A7628-G
    CD204 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7628-ACGLN
    CD204 qPCR Primer Pairs, Mouse MP200159

    CD204 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD204 cDNA ORF Clone in Cloning Vector, Human HG10427-M
    CD204 cDNA ORF Clone, Human, untagged HG10427-UT
    CD204 cDNA ORF Clone, Human, C-GFPSpark® tag HG10427-ACG
    CD204 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10427-ACGLN
    CD204 cDNA ORF Clone, Human, C-OFPSpark® tag HG10427-ACR
    CD204 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10427-CF
    CD204 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10427-NF
    CD204 cDNA ORF Clone, Human, C-His tag HG10427-CH
    CD204 cDNA ORF Clone, Human, N-His tag HG10427-NH
    CD204 cDNA ORF Clone, Human, C-HA tag HG10427-CY
    CD204 cDNA ORF Clone, Human, N-HA tag HG10427-NY
    CD204 cDNA ORF Clone, Human, C-Myc tag HG10427-CM
    CD204 cDNA ORF Clone, Human, N-Myc tag HG10427-NM
    CD204 qPCR Primer Pairs, Human HP100457
    info info
    添加购物车成功! 添加购物车失败!