MSMO1 cDNA ORF Clone, Rat, untagged

Cat: RG81191-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MSMO1 Reagents
CRO Services
Product recommended

All MSMO1 Reagents
MSMO1 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
882 bp
Description
Full length Clone DNA of Rat methylsterol monooxygenase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MSMO1 Background Information
Full Name
methylsterol monooxygenase 1

MSMO1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MSMO1 cDNA ORF Clone in Cloning Vector, Rat RG81191-U
MSMO1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81191-ACG
MSMO1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81191-ACGLN
MSMO1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81191-ANG
MSMO1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81191-ACR
MSMO1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81191-ANR
MSMO1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81191-CF
MSMO1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81191-NF
MSMO1 cDNA ORF Clone, Rat, C-His tag RG81191-CH
MSMO1 cDNA ORF Clone, Rat, N-His tag RG81191-NH
MSMO1 cDNA ORF Clone, Rat, C-HA tag RG81191-CY
MSMO1 cDNA ORF Clone, Rat, N-HA tag RG81191-NY
MSMO1 cDNA ORF Clone, Rat, C-Myc tag RG81191-CM
MSMO1 cDNA ORF Clone, Rat, N-Myc tag RG81191-NM
MSMO1 qPCR Primer Pairs, Rat RP301147

MSMO1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MSMO1 cDNA ORF Clone in Cloning Vector, Human HG16935-U
MSMO1 cDNA ORF Clone, Human, untagged HG16935-UT
MSMO1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16935-ACG
MSMO1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16935-ACGLN
MSMO1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16935-ANG
MSMO1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16935-ACR
MSMO1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16935-ANR
MSMO1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16935-CF
MSMO1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16935-NF
MSMO1 cDNA ORF Clone, Human, C-His tag HG16935-CH
MSMO1 cDNA ORF Clone, Human, N-His tag HG16935-NH
MSMO1 cDNA ORF Clone, Human, C-HA tag HG16935-CY
MSMO1 cDNA ORF Clone, Human, N-HA tag HG16935-NY
MSMO1 cDNA ORF Clone, Human, C-Myc tag HG16935-CM
MSMO1 cDNA ORF Clone, Human, N-Myc tag HG16935-NM
info info
添加购物车成功! 添加购物车失败!