MRPS22 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80537-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRPS22 Reagents
CRO Services
Product recommended

All MRPS22 Reagents
MRPS22 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Rat similar to ribosomal protein, mitochondrial, S22 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About MRPS22
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPS22 Background Information
Full Name
mitochondrial ribosomal protein S22

MRPS22 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRPS22 cDNA ORF Clone in Cloning Vector, Rat RG80537-U
MRPS22 cDNA ORF Clone, Rat, untagged RG80537-UT
MRPS22 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80537-ACG
MRPS22 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80537-ACGLN
MRPS22 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80537-ANG
MRPS22 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80537-ACR
MRPS22 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80537-ANR
MRPS22 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80537-CF
MRPS22 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80537-NF
MRPS22 cDNA ORF Clone, Rat, C-His tag RG80537-CH
MRPS22 cDNA ORF Clone, Rat, N-His tag RG80537-NH
MRPS22 cDNA ORF Clone, Rat, C-HA tag RG80537-CY
MRPS22 cDNA ORF Clone, Rat, C-Myc tag RG80537-CM
MRPS22 cDNA ORF Clone, Rat, N-Myc tag RG80537-NM
MRPS22 qPCR Primer Pairs, Rat RP300501

MRPS22 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPS22 cDNA ORF Clone in Cloning Vector, Human HG16994-U
MRPS22 cDNA ORF Clone, Human, untagged HG16994-UT
MRPS22 cDNA ORF Clone, Human, C-GFPSpark® tag HG16994-ACG
MRPS22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16994-ACGLN
MRPS22 cDNA ORF Clone, Human, N-GFPSpark® tag HG16994-ANG
MRPS22 cDNA ORF Clone, Human, C-OFPSpark® tag HG16994-ACR
MRPS22 cDNA ORF Clone, Human, N-OFPSpark® tag HG16994-ANR
MRPS22 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16994-CF
MRPS22 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16994-NF
MRPS22 cDNA ORF Clone, Human, C-His tag HG16994-CH
MRPS22 cDNA ORF Clone, Human, N-His tag HG16994-NH
MRPS22 cDNA ORF Clone, Human, C-HA tag HG16994-CY
MRPS22 cDNA ORF Clone, Human, N-HA tag HG16994-NY
MRPS22 cDNA ORF Clone, Human, C-Myc tag HG16994-CM
MRPS22 cDNA ORF Clone, Human, N-Myc tag HG16994-NM
info info
添加购物车成功! 添加购物车失败!