MRPL28 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80783-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRPL28 Reagents
CRO Services
Product recommended

All MRPL28 Reagents
MRPL28 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
774 bp
Description
Full length Clone DNA of Rat mitochondrial ribosomal protein L28 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPL28 Background Information
Full Name
mitochondrial ribosomal protein L28

MRPL28 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRPL28 cDNA ORF Clone in Cloning Vector, Rat RG80783-U
MRPL28 cDNA ORF Clone, Rat, untagged RG80783-UT
MRPL28 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80783-ACG
MRPL28 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80783-ACGLN
MRPL28 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80783-ANG
MRPL28 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80783-ACR
MRPL28 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80783-ANR
MRPL28 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80783-CF
MRPL28 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80783-NF
MRPL28 cDNA ORF Clone, Rat, C-His tag RG80783-CH
MRPL28 cDNA ORF Clone, Rat, N-His tag RG80783-NH
MRPL28 cDNA ORF Clone, Rat, C-HA tag RG80783-CY
MRPL28 cDNA ORF Clone, Rat, C-Myc tag RG80783-CM
MRPL28 cDNA ORF Clone, Rat, N-Myc tag RG80783-NM
MRPL28 qPCR Primer Pairs, Rat RP300747

MRPL28 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPL28 cDNA ORF Clone in Cloning Vector, Mouse MG53077-G
MRPL28 cDNA ORF Clone, Mouse, untagged MG53077-UT
MRPL28 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53077-ACG
MRPL28 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53077-ACGLN
MRPL28 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53077-ANG
MRPL28 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53077-ACR
MRPL28 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53077-ANR
MRPL28 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53077-CF
MRPL28 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53077-NF
MRPL28 cDNA ORF Clone, Mouse, C-His tag MG53077-CH
MRPL28 cDNA ORF Clone, Mouse, N-His tag MG53077-NH
MRPL28 cDNA ORF Clone, Mouse, C-HA tag MG53077-CY
MRPL28 cDNA ORF Clone, Mouse, N-HA tag MG53077-NY
MRPL28 cDNA ORF Clone, Mouse, C-Myc tag MG53077-CM
MRPL28 cDNA ORF Clone, Mouse, N-Myc tag MG53077-NM

MRPL28 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPL28 cDNA ORF Clone in Cloning Vector, Human HG16186-G
MRPL28 cDNA ORF Clone, Human, untagged HG16186-UT
MRPL28 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16186-ACGLN
MRPL28 cDNA ORF Clone, Human, C-GFPSpark® tag HG16186-ACG
MRPL28 cDNA ORF Clone, Human, N-GFPSpark® tag HG16186-ANG
MRPL28 cDNA ORF Clone, Human, C-OFPSpark® tag HG16186-ACR
MRPL28 cDNA ORF Clone, Human, N-OFPSpark® tag HG16186-ANR
MRPL28 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16186-CF
MRPL28 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16186-NF
MRPL28 cDNA ORF Clone, Human, C-His tag HG16186-CH
MRPL28 cDNA ORF Clone, Human, N-His tag HG16186-NH
MRPL28 cDNA ORF Clone, Human, C-HA tag HG16186-CY
MRPL28 cDNA ORF Clone, Human, N-HA tag HG16186-NY
MRPL28 cDNA ORF Clone, Human, C-Myc tag HG16186-CM
MRPL28 cDNA ORF Clone, Human, N-Myc tag HG16186-NM
MRPL28 qPCR Primer Pairs, Human HP104955
info info
添加购物车成功! 添加购物车失败!