MRPL17 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81276-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRPL17 Reagents
CRO Services
Product recommended

All MRPL17 Reagents
MRPL17 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Rat mitochondrial ribosomal protein L17 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPL17 cDNA ORF Clone, Rat, C-Myc tag Alternative Names
L17mt cDNA ORF Clone, Rat;MRP-L17 cDNA ORF Clone, Rat
MRPL17 Background Information
Full Name
mitochondrial ribosomal protein L17

MRPL17 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRPL17 cDNA ORF Clone in Cloning Vector, Rat RG81276-U
MRPL17 cDNA ORF Clone, Rat, untagged RG81276-UT
MRPL17 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81276-ACGLN
MRPL17 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81276-ACG
MRPL17 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81276-ANG
MRPL17 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81276-ACR
MRPL17 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81276-ANR
MRPL17 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81276-CF
MRPL17 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81276-NF
MRPL17 cDNA ORF Clone, Rat, C-His tag RG81276-CH
MRPL17 cDNA ORF Clone, Rat, N-His tag RG81276-NH
MRPL17 cDNA ORF Clone, Rat, C-HA tag RG81276-CY
MRPL17 cDNA ORF Clone, Rat, N-HA tag RG81276-NY
MRPL17 cDNA ORF Clone, Rat, N-Myc tag RG81276-NM
MRPL17 qPCR Primer Pairs, Rat RP301232

MRPL17 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPL17 cDNA ORF Clone in Cloning Vector, Mouse MG53556-G
MRPL17 cDNA ORF Clone, Mouse, untagged MG53556-UT
MRPL17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53556-ACGLN
MRPL17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53556-ACG
MRPL17 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53556-ANG
MRPL17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53556-ACR
MRPL17 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53556-ANR
MRPL17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53556-CF
MRPL17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53556-NF
MRPL17 cDNA ORF Clone, Mouse, C-His tag MG53556-CH
MRPL17 cDNA ORF Clone, Mouse, N-His tag MG53556-NH
MRPL17 cDNA ORF Clone, Mouse, C-HA tag MG53556-CY
MRPL17 cDNA ORF Clone, Mouse, N-HA tag MG53556-NY
MRPL17 cDNA ORF Clone, Mouse, C-Myc tag MG53556-CM
MRPL17 cDNA ORF Clone, Mouse, N-Myc tag MG53556-NM
info info
添加购物车成功! 添加购物车失败!