MPV17L cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81245-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MPV17L Reagents
CRO Services
Product recommended

All MPV17L Reagents
MPV17L cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Rat MPV17 mitochondrial membrane protein-like with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MPV17L Background Information
Full Name
MPV17 mitochondrial membrane protein-like

MPV17L cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MPV17L cDNA ORF Clone in Cloning Vector, Rat RG81245-G
MPV17L cDNA ORF Clone, Rat, untagged RG81245-UT
MPV17L cDNA ORF Clone, Rat, C-GFPSpark® tag RG81245-ACG
MPV17L Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81245-ACGLN
MPV17L cDNA ORF Clone, Rat, N-GFPSpark® tag RG81245-ANG
MPV17L cDNA ORF Clone, Rat, C-OFPSpark® tag RG81245-ACR
MPV17L cDNA ORF Clone, Rat, N-OFPSpark® tag RG81245-ANR
MPV17L cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81245-CF
MPV17L cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81245-NF
MPV17L cDNA ORF Clone, Rat, C-His tag RG81245-CH
MPV17L cDNA ORF Clone, Rat, N-His tag RG81245-NH
MPV17L cDNA ORF Clone, Rat, C-HA tag RG81245-CY
MPV17L cDNA ORF Clone, Rat, N-HA tag RG81245-NY
MPV17L cDNA ORF Clone, Rat, N-Myc tag RG81245-NM
MPV17L qPCR Primer Pairs, Rat RP301201

MPV17L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MPV17L cDNA ORF Clone in Cloning Vector, Mouse MG53294-U
MPV17L cDNA ORF Clone, Mouse, untagged MG53294-UT
MPV17L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53294-ACGLN
MPV17L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53294-ACG
MPV17L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53294-ACR
MPV17L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53294-CF
MPV17L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53294-NF
MPV17L cDNA ORF Clone, Mouse, C-His tag MG53294-CH
MPV17L cDNA ORF Clone, Mouse, N-His tag MG53294-NH
MPV17L cDNA ORF Clone, Mouse, C-HA tag MG53294-CY
MPV17L cDNA ORF Clone, Mouse, N-HA tag MG53294-NY
MPV17L cDNA ORF Clone, Mouse, C-Myc tag MG53294-CM
MPV17L cDNA ORF Clone, Mouse, N-Myc tag MG53294-NM
info info
添加购物车成功! 添加购物车失败!