MPST cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81205-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MPST Reagents
CRO Services
Product recommended

All MPST Reagents
MPST cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
894 bp
Description
Full length Clone DNA of Rat mercaptopyruvate sulfurtransferase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MPST Background Information
Full Name
mercaptopyruvate sulfurtransferase

MPST cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MPST cDNA ORF Clone in Cloning Vector, Rat RG81205-U
MPST cDNA ORF Clone, Rat, untagged RG81205-UT
MPST Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81205-ACGLN
MPST cDNA ORF Clone, Rat, C-GFPSpark® tag RG81205-ACG
MPST cDNA ORF Clone, Rat, N-GFPSpark® tag RG81205-ANG
MPST cDNA ORF Clone, Rat, C-OFPSpark® tag RG81205-ACR
MPST cDNA ORF Clone, Rat, N-OFPSpark® tag RG81205-ANR
MPST cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81205-CF
MPST cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81205-NF
MPST cDNA ORF Clone, Rat, C-His tag RG81205-CH
MPST cDNA ORF Clone, Rat, N-His tag RG81205-NH
MPST cDNA ORF Clone, Rat, C-HA tag RG81205-CY
MPST cDNA ORF Clone, Rat, N-HA tag RG81205-NY
MPST cDNA ORF Clone, Rat, N-Myc tag RG81205-NM
MPST qPCR Primer Pairs, Rat RP301161

MPST cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MPST cDNA ORF Clone in Cloning Vector, Mouse MG53460-U
MPST cDNA ORF Clone, Mouse, untagged MG53460-UT
MPST Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53460-ACGLN
MPST cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53460-ACG
MPST cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53460-ANG
MPST cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53460-ACR
MPST cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53460-ANR
MPST cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53460-CF
MPST cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53460-NF
MPST cDNA ORF Clone, Mouse, C-His tag MG53460-CH
MPST cDNA ORF Clone, Mouse, N-His tag MG53460-NH
MPST cDNA ORF Clone, Mouse, C-HA tag MG53460-CY
MPST cDNA ORF Clone, Mouse, N-HA tag MG53460-NY
MPST cDNA ORF Clone, Mouse, C-Myc tag MG53460-CM
MPST cDNA ORF Clone, Mouse, N-Myc tag MG53460-NM

MPST cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MPST cDNA ORF Clone in Cloning Vector, Human HG16368-G
MPST cDNA ORF Clone, Human, untagged HG16368-UT
MPST Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16368-ACGLN
MPST cDNA ORF Clone, Human, C-GFPSpark® tag HG16368-ACG
MPST cDNA ORF Clone, Human, N-GFPSpark® tag HG16368-ANG
MPST cDNA ORF Clone, Human, C-OFPSpark® tag HG16368-ACR
MPST cDNA ORF Clone, Human, N-OFPSpark® tag HG16368-ANR
MPST cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16368-CF
MPST cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16368-NF
MPST cDNA ORF Clone, Human, C-His tag HG16368-CH
MPST cDNA ORF Clone, Human, N-His tag HG16368-NH
MPST cDNA ORF Clone, Human, C-HA tag HG16368-CY
MPST cDNA ORF Clone, Human, N-HA tag HG16368-NY
MPST cDNA ORF Clone, Human, C-Myc tag HG16368-CM
MPST cDNA ORF Clone, Human, N-Myc tag HG16368-NM
MPST qPCR Primer Pairs, Human HP105118
info info
添加购物车成功! 添加购物车失败!