CD10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80288-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD10 Reagents
CRO Services
Product recommended

All CD10 Reagents
CD10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2253 bp
Description
Full length Clone DNA of Rat membrane metallo-endopeptidase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD10 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 10 (CD10), also known as Neprilysin and neutral endopeptidase, is a member of the CD system. CD10 is a zinc-dependent metalloprotease enzyme that had function to degrade a number of small secreted peptides such as the amyloid beta peptide. It exist as a membrane-bound protein and have high concentration in kidney and lung tissues. Mutations in the CD10 gene can induce the familial forms of Alzheimer's disease, providing strong evidence for the protein's association with the Alzheimer's disease process. CD10 is also associated with other biochemical processes.

Full Name
membrane metallo-endopeptidase
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Dogan, et al. (2000) CD10 and BCL-6 Expression in Paraffin Sections of Normal Lymphoid Tissue and B-Cell Lymphomas. American Journal of Surgical Pathology. 24(6): 846-52.
  • CD10 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD10 cDNA ORF Clone in Cloning Vector, Rhesus CG90177-G
    CD10 cDNA ORF Clone, Rhesus, untagged CG90177-UT
    CD10 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90177-ACG
    CD10 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90177-ACGLN
    CD10 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90177-ACR
    CD10 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90177-CF
    CD10 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90177-NF
    CD10 cDNA ORF Clone, Rhesus, C-His tag CG90177-CH
    CD10 cDNA ORF Clone, Rhesus, N-His tag CG90177-NH
    CD10 cDNA ORF Clone, Rhesus, C-HA tag CG90177-CY
    CD10 cDNA ORF Clone, Rhesus, N-HA tag CG90177-NY
    CD10 cDNA ORF Clone, Rhesus, C-Myc tag CG90177-CM
    CD10 cDNA ORF Clone, Rhesus, N-Myc tag CG90177-NM

    CD10 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD10 cDNA ORF Clone in Cloning Vector, Rat RG80288-G
    CD10 cDNA ORF Clone, Rat, untagged RG80288-UT
    CD10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80288-ACG
    CD10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80288-ACGLN
    CD10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80288-ACR
    CD10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80288-CF
    CD10 cDNA ORF Clone, Rat, C-His tag RG80288-CH
    CD10 cDNA ORF Clone, Rat, N-His tag RG80288-NH
    CD10 cDNA ORF Clone, Rat, C-HA tag RG80288-CY
    CD10 cDNA ORF Clone, Rat, N-HA tag RG80288-NY
    CD10 cDNA ORF Clone, Rat, C-Myc tag RG80288-CM
    CD10 cDNA ORF Clone, Rat, N-Myc tag RG80288-NM
    CD10 qPCR Primer Pairs, Rat RP300266

    CD10 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD10 cDNA ORF Clone in Cloning Vector, Mouse MG50218-G
    CD10 cDNA ORF Clone, Mouse, untagged MG50218-UT
    CD10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50218-ACG
    CD10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50218-ACGLN
    CD10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50218-ACR
    CD10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50218-CF
    CD10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50218-NF
    CD10 cDNA ORF Clone, Mouse, C-His tag MG50218-CH
    CD10 cDNA ORF Clone, Mouse, N-His tag MG50218-NH
    CD10 cDNA ORF Clone, Mouse, C-HA tag MG50218-CY
    CD10 cDNA ORF Clone, Mouse, N-HA tag MG50218-NY
    CD10 cDNA ORF Clone, Mouse, C-Myc tag MG50218-CM
    CD10 cDNA ORF Clone, Mouse, N-Myc tag MG50218-NM
    CD10 qPCR Primer Pairs, Mouse MP200245

    CD10 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD10 cDNA ORF Clone in Cloning Vector, Human HG10805-M
    CD10 cDNA ORF Clone, Human, untagged HG10805-UT
    CD10 cDNA ORF Clone, Human, C-GFPSpark® tag HG10805-ACG
    CD10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10805-ACGLN
    CD10 cDNA ORF Clone, Human, C-OFPSpark® tag HG10805-ACR
    CD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10805-CF
    CD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10805-NF
    CD10 cDNA ORF Clone, Human, C-His tag HG10805-CH
    CD10 cDNA ORF Clone, Human, N-His tag HG10805-NH
    CD10 cDNA ORF Clone, Human, C-HA tag HG10805-CY
    CD10 cDNA ORF Clone, Human, N-HA tag HG10805-NY
    CD10 cDNA ORF Clone, Human, C-Myc tag HG10805-CM
    CD10 cDNA ORF Clone, Human, N-Myc tag HG10805-NM
    CD10 qPCR Primer Pairs, Human HP100910
    info info
    添加购物车成功! 添加购物车失败!