MGAT3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80436-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MGAT3 Reagents
CRO Services
Product recommended

All MGAT3 Reagents
MGAT3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1617 bp
Description
Full length Clone DNA of Rat mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MGAT3 Background Information
Full Name
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase

MGAT3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MGAT3 cDNA ORF Clone in Cloning Vector, Rat RG80436-G
MGAT3 cDNA ORF Clone, Rat, untagged RG80436-UT
MGAT3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80436-ACGLN
MGAT3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80436-ACG
MGAT3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80436-ACR
MGAT3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80436-CF
MGAT3 cDNA ORF Clone, Rat, C-His tag RG80436-CH
MGAT3 cDNA ORF Clone, Rat, N-His tag RG80436-NH
MGAT3 cDNA ORF Clone, Rat, C-HA tag RG80436-CY
MGAT3 cDNA ORF Clone, Rat, N-HA tag RG80436-NY
MGAT3 cDNA ORF Clone, Rat, C-Myc tag RG80436-CM
MGAT3 cDNA ORF Clone, Rat, N-Myc tag RG80436-NM
MGAT3 qPCR Primer Pairs, Rat RP300408

MGAT3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MGAT3 cDNA ORF Clone in Cloning Vector, Mouse MG51120-G
MGAT3 cDNA ORF Clone, Mouse, untagged MG51120-UT
MGAT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51120-ACG
MGAT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51120-ACGLN
MGAT3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51120-ACR
MGAT3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51120-CF
MGAT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51120-NF
MGAT3 cDNA ORF Clone, Mouse, C-His tag MG51120-CH
MGAT3 cDNA ORF Clone, Mouse, N-His tag MG51120-NH
MGAT3 cDNA ORF Clone, Mouse, C-HA tag MG51120-CY
MGAT3 cDNA ORF Clone, Mouse, N-HA tag MG51120-NY
MGAT3 cDNA ORF Clone, Mouse, C-Myc tag MG51120-CM
MGAT3 cDNA ORF Clone, Mouse, N-Myc tag MG51120-NM
MGAT3 qPCR Primer Pairs, Mouse MP201070

MGAT3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MGAT3 cDNA ORF Clone, Human, untagged HG17761-UT
info info
添加购物车成功! 添加购物车失败!