MFI2 cDNA ORF Clone, Rat, N-His tag

Cat: RG80403-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MFI2 Reagents
CRO Services
Product recommended

All MFI2 Reagents
MFI2 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2217 bp
Description
Full length Clone DNA of Rat antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MFI2 Background Information
Full Name
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
References
  • Richardson DR. (2000) The role of the membrane-bound tumour antigen, melanotransferrin (p97), in iron uptake by the human malignant melanoma cell. Eur J Biochem. 267(5): 1290-8.
  • Kim DK, et al. (2001) Serum melanotransferrin, p97 as a biochemical marker of Alzheimer's disease. Neuropsychopharmacology. 25(1): 84-90.
  • Rothenberger S, et al. (1996) Coincident expression and distribution of melanotransferrin and transferrin receptor in human brain capillary endothelium. Brain Res. 712(1): 117-21.
  • Baker EN, et al. (1992) Human melanotransferrin (p97) has only one functional iron-binding site. FEBS Lett. 298(2-3): 215-8.
  • MFI2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    MFI2 cDNA ORF Clone in Cloning Vector, Rat RG80403-G
    MFI2 cDNA ORF Clone, Rat, untagged RG80403-UT
    MFI2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80403-ACGLN
    MFI2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80403-ACG
    MFI2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80403-ACR
    MFI2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80403-CF
    MFI2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80403-NF
    MFI2 cDNA ORF Clone, Rat, C-His tag RG80403-CH
    MFI2 cDNA ORF Clone, Rat, C-HA tag RG80403-CY
    MFI2 cDNA ORF Clone, Rat, N-HA tag RG80403-NY
    MFI2 cDNA ORF Clone, Rat, C-Myc tag RG80403-CM
    MFI2 cDNA ORF Clone, Rat, N-Myc tag RG80403-NM
    MFI2 qPCR Primer Pairs, Rat RP300368

    MFI2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MFI2 cDNA ORF Clone in Cloning Vector, Mouse MG50994-G
    MFI2 cDNA ORF Clone, Mouse, untagged MG50994-UT
    MFI2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50994-ACG
    MFI2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50994-ACGLN
    MFI2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50994-ACR
    MFI2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50994-CF
    MFI2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50994-NF
    MFI2 cDNA ORF Clone, Mouse, C-His tag MG50994-CH
    MFI2 cDNA ORF Clone, Mouse, N-His tag MG50994-NH
    MFI2 cDNA ORF Clone, Mouse, C-HA tag MG50994-CY
    MFI2 cDNA ORF Clone, Mouse, N-HA tag MG50994-NY
    MFI2 cDNA ORF Clone, Mouse, C-Myc tag MG50994-CM
    MFI2 cDNA ORF Clone, Mouse, N-Myc tag MG50994-NM
    MFI2 qPCR Primer Pairs, Mouse MP200960
    info info
    添加购物车成功! 添加购物车失败!