Quick Order

Text Size:AAA

Rat MFI2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Rat MFI2 cDNA Clone Product Information
NCBI RefSeq:NM_001105872.1
RefSeq ORF Size:2217bp
cDNA Description:Full length Clone DNA of Rattus norvegicus antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 with N terminal His tag.
Gene Synonym:Mfi2
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Richardson DR. (2000) The role of the membrane-bound tumour antigen, melanotransferrin (p97), in iron uptake by the human malignant melanoma cell. Eur J Biochem. 267(5): 1290-8.
  • Kim DK, et al. (2001) Serum melanotransferrin, p97 as a biochemical marker of Alzheimer's disease. Neuropsychopharmacology. 25(1): 84-90.
  • Rothenberger S, et al. (1996) Coincident expression and distribution of melanotransferrin and transferrin receptor in human brain capillary endothelium. Brain Res. 712(1): 117-21.
  • Baker EN, et al. (1992) Human melanotransferrin (p97) has only one functional iron-binding site. FEBS Lett. 298(2-3): 215-8.
  • Size / Price
    Catalog: RG80403-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"