MFAP2 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80747-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MFAP2 Reagents
CRO Services
Product recommended

All MFAP2 Reagents
MFAP2 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
558 bp
Description
Full length Clone DNA of Rat microfibrillar-associated protein 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MFAP2 Background Information
Full Name
microfibrillar-associated protein 2

MFAP2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MFAP2 cDNA ORF Clone in Cloning Vector, Rhesus CG90506-U
MFAP2 cDNA ORF Clone, Rhesus, untagged CG90506-UT
MFAP2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90506-ACGLN
MFAP2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90506-ACG
MFAP2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90506-ACR
MFAP2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90506-CF
MFAP2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90506-NF
MFAP2 cDNA ORF Clone, Rhesus, C-His tag CG90506-CH
MFAP2 cDNA ORF Clone, Rhesus, N-His tag CG90506-NH
MFAP2 cDNA ORF Clone, Rhesus, C-HA tag CG90506-CY
MFAP2 cDNA ORF Clone, Rhesus, N-HA tag CG90506-NY
MFAP2 cDNA ORF Clone, Rhesus, C-Myc tag CG90506-CM
MFAP2 cDNA ORF Clone, Rhesus, N-Myc tag CG90506-NM

MFAP2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MFAP2 cDNA ORF Clone in Cloning Vector, Rat RG80747-U
MFAP2 cDNA ORF Clone, Rat, untagged RG80747-UT
MFAP2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80747-ACG
MFAP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80747-ACGLN
MFAP2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80747-ACR
MFAP2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80747-CF
MFAP2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80747-NF
MFAP2 cDNA ORF Clone, Rat, C-His tag RG80747-CH
MFAP2 cDNA ORF Clone, Rat, N-His tag RG80747-NH
MFAP2 cDNA ORF Clone, Rat, C-HA tag RG80747-CY
MFAP2 cDNA ORF Clone, Rat, C-Myc tag RG80747-CM
MFAP2 cDNA ORF Clone, Rat, N-Myc tag RG80747-NM
MFAP2 qPCR Primer Pairs, Rat RP300711

MFAP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MFAP2 cDNA ORF Clone in Cloning Vector, Human HG16644-U
MFAP2 cDNA ORF Clone, Human, untagged HG16644-UT
MFAP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16644-ACG
MFAP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16644-ACGLN
MFAP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16644-ACR
MFAP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16644-CF
MFAP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16644-NF
MFAP2 cDNA ORF Clone, Human, C-His tag HG16644-CH
MFAP2 cDNA ORF Clone, Human, N-His tag HG16644-NH
MFAP2 cDNA ORF Clone, Human, C-HA tag HG16644-CY
MFAP2 cDNA ORF Clone, Human, N-HA tag HG16644-NY
MFAP2 cDNA ORF Clone, Human, C-Myc tag HG16644-CM
MFAP2 cDNA ORF Clone, Human, N-Myc tag HG16644-NM
info info
添加购物车成功! 添加购物车失败!