METTL1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80983-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All METTL1 Reagents
CRO Services
Product recommended

All METTL1 Reagents
METTL1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
804 bp
Description
Full length Clone DNA of Rat methyltransferase like 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METTL1 Background Information

tRNA (guanine-N(7)-)-methyltransferase, also known as Methyltransferase-like protein 1, tRNA (m7G46)-methyltransferase and METTL1, is a nucleus protein which belongs to the methyltransferase superfamily and TrmB family. METTL1 gene, has been identified by its sequence similarity to the yeast ORF YDL201w. The human cDNA and the genomic structure of METTL1 have been analyzed. The transcript contains 1292 nucleotides and codes for a protein of 276 amino acids. The METTL1 gene product shows high sequence similarities to putative proteins from mouse, Drosophila melanogaster, Arabidopsis thaliana, Caenorhabditis elegans, and yeast (39.8% identity between all six species). Computer analyses of the deduced protein sequence reveal two highly conserved amino acid motifs, one of which is typical for methyltransferases. Both motifs are also present in hypothetical proteins from eubacteria. Disruption of the homologous yeast ORF YDL201w shows that the gene is at least not essential for vegetative growth in Saccharomyces cerevisiae.

Full Name
methyltransferase like 1
References
  • Bahr, A.et al., 1999, Genomics. 57 (3):424-8.
  • Wikman, H. et al., 2005,Genes Chromosomes Cancer. 42 (2):193-9.
  • Cartlidge, RA. et al., 2005, EMBO J. 24 (9):1696-705.
  • METTL1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    METTL1 cDNA ORF Clone in Cloning Vector, Rat RG80983-U
    METTL1 cDNA ORF Clone, Rat, untagged RG80983-UT
    METTL1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80983-ACG
    METTL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80983-ACGLN
    METTL1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80983-ANG
    METTL1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80983-ACR
    METTL1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80983-ANR
    METTL1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80983-CF
    METTL1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80983-NF
    METTL1 cDNA ORF Clone, Rat, C-His tag RG80983-CH
    METTL1 cDNA ORF Clone, Rat, N-His tag RG80983-NH
    METTL1 cDNA ORF Clone, Rat, C-HA tag RG80983-CY
    METTL1 cDNA ORF Clone, Rat, N-HA tag RG80983-NY
    METTL1 cDNA ORF Clone, Rat, C-Myc tag RG80983-CM
    METTL1 qPCR Primer Pairs, Rat RP300947

    METTL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    METTL1 cDNA ORF Clone in Cloning Vector, Human HG11525-M
    METTL1 cDNA ORF Clone, Human, untagged HG11525-UT
    METTL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11525-ACG
    METTL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11525-ACGLN
    METTL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11525-ANG
    METTL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11525-ACR
    METTL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11525-ANR
    METTL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11525-CF
    METTL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11525-NF
    METTL1 cDNA ORF Clone, Human, C-His tag HG11525-CH
    METTL1 cDNA ORF Clone, Human, N-His tag HG11525-NH
    METTL1 cDNA ORF Clone, Human, C-HA tag HG11525-CY
    METTL1 cDNA ORF Clone, Human, N-HA tag HG11525-NY
    METTL1 cDNA ORF Clone, Human, C-Myc tag HG11525-CM
    METTL1 cDNA ORF Clone, Human, N-Myc tag HG11525-NM
    METTL1 qPCR Primer Pairs, Human HP101395
    info info
    添加购物车成功! 添加购物车失败!